БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции

Pages:     | 1 || 3 | 4 |   ...   | 19 |

«НАУЧНЫЙ ФАКТОР В СТРАТЕГИИ ИННОВАЦИОННОГО РАЗВИТИЯ СВИНОВОДСТВА Сборник материалов XXII Международной научно-практической конференции 9-11 сентября 2015 г. Гродно ГГАУ УДК ...»

-- [ Страница 2 ] --

10. Тихонов В.Н. Повышение эффективности беконного свиноводства путем промышленного и переменного скрещивания // Сб. тр./Латвийский НИИЖ и В.- Рига, 1958.- т.9.С.25-77.

11. Кащенко А.Х. Промышленное скрещивание свиней крупной белой, беркширской и миргородской пород и его организация в пользовательном свиноводстве // Науч.тр./ ПНИИС, 1958.- Т.21.- С.5-18.

12. Шестиперов А.А. Сравнительная эффективность различных форм промышленного скрещивания // Повышение продуктивности сельскохозяйственных животных.- М., 1961.С.51-63.

13. Кудрявцев П.Н. Значение переменного скрещивания в пользовательном свиноводстве // Животноводство.- 1960.- №2.- С.22-28.

14. Кудрявцев П.Н. Повышение продуктивности, снижение затрат корма у свиней при промышленном и переменном скрещивании различных пород с ландрасами // Ландрасы госплемзавода «Кудиново».- М., 1967.- С.19-45.

15. Эктов В.А. Переменное скрещивание в свиноводстве.- М., 1964.- С.67-86.

16. Мухортов В.И. Плодовитость и крупноплодность при простом и переменном скрещивании в свиноводстве с использованием свиней породы ландрас // Труды Калужской областной с.-х. опытной станции.- 1968.- Т.4.- С.162-167.

17. Смирнова Л. Переменное скрещивание в промышленном свиноводстве // Свиноводство.- 1982.- С.23-24.

18. Гильман З.Д., Стрельцов В.А. Предварительные результаты испытания новой технологии племенной работы для комплексов не имеющих племферм // Материалы научной конференции «Генетика и селекция растений». Секция «Новое в технологии разведения и содержания племенных свиней». Байсогала, 19-20 июня 1985.- Вильнюс, 1985.- С.59-60.

19. Гильман З.Д., Мордечко П.П. Многоплодие свиноматок при различных системах племенной работы//Ученые записки Гродненского сельскохозяйственного института: Сб.

науч. тр. – Гродно, 1995. – Вып. 5. – С. 117-118.

УДК 636.082:575

–  –  –

Введение. Рецептор лептина принадлежит к семейству цитокиновых рецепторов класса I и является одним из компонентов системы регулирования энергетического гомеостаза организма. Он модулирует эффекты лептина, адипоцит-производного белкового гормона, участвующего в контроле интенсивности поглощения пищи, регуляции веса тела животных и накоплении жира. У свиней ген рецептора лептина (LEPR) локализован в 6-й хромосоме в регионе, для которого установлена ассоциация с такими признаками продуктивности, как содержание внутримышечного жира, толщина шпика, интенсивность роста и параметры структуры туши [1-6]. На основании этого его относят к кандидатным генам локусов количественных признаков.

Ген рецептора лептина LEPR имеет в своем составе 20 экзонов. В его структуре обнаружено не менее 26 однонуклеотидных полиморфизмов (SNP), которые локализованы в интронах, экзонах и прилегающих к гену участках [7-13]. Для ряда SNP в гене LEPR установлены частоты аллелей и уровни полиморфизма, оценена их ассоциация с признаками продуктивности и качеством мяса. Для отечественных и зарубежных пород свиней, разводимых в Украине, исследования, касающиеся полиморфизма и ассоциации гена LEPR с параметрами продуктивности и качества мяса свиней, не проводились. Включение в селекционные программы генетических маркеров на основе полиморфизма гена LEPR может значительно ускорить процесс достижения желательных показателей продуктивности.

Целью настоящих исследований было провести анализ полиморфизма (с. 1987СТ) гена LEPR в популяциях свиней разных пород и установить его связь с качеством мяса свиней украинской крупной белой породы.

Материалы и методы исследований. Для генетико-популяционного анализа был использованы образцы ДНК свиней 9 пород из банка ДНК лаборатории генетики Института свиноводства и АПП: украинской крупной белой (УКБ, n=93), украинской степной белой (УСБ, n=9), украинской степной рябой (УСР, n=18), миргородской (Мир, n=36), полтавской мясной (ПМ, n=28), ландрас (Л, n=29), пьетрен (П, n=8), мейшан (M, n=5) и крупной черной (КЧ, n=48).

Ассоциативные исследования были проведены на 60 головах свиней украинской крупной белой породы, которых откармливали до массы 108 кг в опытном хозяйстве Института свиноводства и АПП (п/з «Степное», Полтавской области). Разрешение на использование животных утверждено Ученым Советом Института свиноводства и АПП НААН Украины в соответствии с Европейской конвенцией по защите позвоночных животных, используемых для экспериментальных и других научных целей [14].

Геномную ДНК выделяли из образцов мяса сорбентным методом с использованием набора «DiatomTMDNA Prep 100» («Isogen», Россия, Москва).

LEPR генотипирование проводили по SNP с. 1987СТ с использованием метода TagMan реал-тайм ПЦР (SNP Genotyping Assays Kit, Applied Biosystems, США). Структура праймеров: F: CAGAGGACCTGAATTTTGGAG, R: CATAAAAATCAGAAATACCTTCCAG.

Образцы мяса для анализа отбирали из длиннейшей мышцы спины правой полутуши между 9-12 грудными позвонками после 24-часового созревания в режиме постепенного охлаждения при температуре от +2 до С.

Влагоудерживающая способность определялась методом прессования по Р. Грау и Р. Гамм в модификации В. Воловинской и Б. Кельман согласно методическим рекомендациям ВАСХНИЛ [15].

Содержание сухого вещества и общей влаги в мясе определялись согласно методикам нормативных документов ГОСТ 9793-74 «Продукты мясные. Методы определения влаги» и ГОСТ 23042-86 «Мясо и мясные продукты. Методы определения жира», содержание протеина – расчетным методом. Определение содержания внутримышечного жира в пробах мяса проводили с помощью экстракции образцов петролейным эфиром по методу Soxhlet.

Генетико-популяционные параметры были рассчитаны с использованием программы [16]. Обработку экспериментальных данных для определения ассоциации генотипов с показателями качества мяса проводили методом однофакторного анализа с использованием расчетной среды табличного процессора Microsoft Office Excel 2007.

Результаты исследований. Для генотипирования по гену LEPR был выбран SNP с. 1987СТ (в некоторых работах обозначается как с.2002СТ), p. Leu663Phe, для которого обнаружены существенные ассоциации с признаками продуктивности и качеством мяса свиней [11, 17].

Проведен генетико-популяционный анализ в отношении данного гена в изучаемых породах свиней, результаты которого представлены в таблице 1.

–  –  –

0,399 Внутримышечный жир, 1,985 1,382 2,607 14,212 0,229 % (1,113 (27) (0,837 (27) (1,179 (6) 0,029* 0,005** Влагоудерживающая 56,604 58,773 56,228 4,428 0,790 способность, % (2,665 (17) (8,903 (6) (1,403 (4) 0,364 0,593 Примечание: s.d. – стандартное отклонение, n – число животных, 2 – степень влияния генотипа на показатель, P – уровень достоверности различий между генотипами CC/TT, CC/CT, CT/TT Наши результаты подтверждают данные, полученные Munoz G. et al.

[10] на кроссбредных свиньях дюрок х иберийская порода и PerezMontarelo D. [11] на экспериментальной группе свиней иберийская порода х ландрас, свидетельствующие о том, что аллель c.1987T ассоциирован с большим содержанием жира в мясе в сравнении с аллелем c.1987C.

Заключение. Исследования показали статистически значимые влияния генотипов гена LEPR на содержание внутримышечного жира, общую влагу и содержание сухого вещества в мясе свиней крупной белой породы. Генетический маркер LEPR SNP NM001024587.1, с. 1987СТ может быть использован в маркерной селекции на улучшение показателей качества мяса свиней крупной белой породы.


1. Detection of quantitative trait loci for growth and fatness in pigs / J. P. Bidanel [et al.] // Genetics, Selection, Evolution. – 2001. – Vol. 33. – P. 289–309. – Also: Milan D., Iannuccelli N., Amigues Y., Boscher M.Y., Bourgeois F., Caritez J.C., Gruand J., Le Roy P., Lagant H., Quintanilla R., Renard C., Gellin J., Ollivier L., Chevalet C.

2. A QTL for intramuscular fat and backfat thickness is located on porcine chromosome 6 / C.

Ovilo [et al.] // Mammalian Genome. – 2000. – Vol. 11. – P. 344–346. - Also: Perez-Enciso M., Barragan C., Clop A., Rodriquez C., Oliver M.A., Toro M.A., Noguera J.L.

3. Test for positional candidate genes for body composition on pig chromosome 6 / C. Ovilo [et al.] // Genetics, Selection, Evolution. – 2000a. – Vol. 34. – P. 465–479. – Also: Oliver A., Noguera J.L., Clop A., Barragan C., Varona L., Rodriguez C., Toro M., Sanchez A., Perez-Enciso M., Silio L.

4. Discrimination between linked and pleiotropic QTL on pig chromosome 6 by multitrait least squares analysis / C. Ovilo [et al.] // Proceedings of the 7th World Congress on Genetics Applied to Livestock Production (Montpellier). – 2002b. – Vol. 30. – P. 51–54. – Also: Varona L., Barragan C., Clop A., Rodriguez C., Toro M., Silio L., Sanchez A., Noguera J.L.

5. Fine mapping of porcine chromosome 6 QTL and LEPR effects on body composition in multiple generations of an Iberian by Landrace intercross / C. Ovilo [et al.] // Genet. Res. – 2005. – Vol. 85(1). – P. 57-67.

6. QTL mapping for growth and carcass traits in an Iberian by Landrace pig intercross: additive, dominant and epistatic effects / L. Varona [et al.] // Genetical Research. – 2002. – Vol. 80. – P.

145–154. – Also: Ovilo C., Clop A., Noguera J.L., PerezEnciso M., Coll A., Folch J.M., Barragan C., Toro M.A., Babot D., Sanchez A.

7. Chen, C. C. Characterization of porcine leptin receptor polymorphisms and their association with reproduction and production traits / C. C. Chen, T. Chang, H. Y. Su // Animal biotechnology.

– 2004. – Vol. 15(1). – P. 89–102.

8. Missense mutations in exon 4 of the porcine LEPR gene encoding extracellular domain and their association with fatness traits / M. Mackowski [et al.] // Anim. Genet. – 2005. – Vol. 36(2). – P. 135-137. – Also: Szymoniak K., Szydlowski M., Kamyczek M., Eckert R., Rozycki M., Switonski M.

9. Plasma leptin levels in pigs with different leptin and leptin receptor genotypes / M. Amills [et al.] // J. Anim. Breed. Genet. – 2008. – Vol. 125. – P. 228–23. – Also: Villalba D., Tor M., Mercade A., Gallardo D., Cabrera B., Jime nez N., Noguera J.L., Sa`nchez1 A., Estany J.

10. Single- and joint-population analyses of two experimental pig crosses to confirm quantitative trait loci on Sus scrofa chromosome 6 and leptin receptor effects on fatness and growth traits / G. Muoz [et al.] // J. Anim. Sci. – 2009. – Vol. 87(2). – P. 459-68. – Also: Ovilo C., Sili L., Toms A., Noguera J.L., Rodrguez M.C.

11. Joint effects of porcine leptin and leptin receptor polymorphisms on productivity and quality traits / D. Prez-Montarelo [et al.] // Animal Genetics. – 2012. – Vol. 43(6). – P. 805–809. – Also:, Fernndez A., Folch J.M., Pena R.N., vilo C.

12. Evaluation of effects of multiple candidate genes (LEP, LEPR, MC4R, PIK3C3, and VRTN) on production traits in Duroc pigs / Kensuke Ito [et al.] // Animal science journal = Nihon chikusan Gakkaih (2013-10-15 Hirose). – 2013. – Also: Tetsuya Fukawa, Kazuo Arakawa, Aisaku·Mikawa, Satoshi Hayashi, Yoichi Tanaka, Kazuaki

13. Mazalov, L. Variability of LEPR gene and his association with indicators of production pork : Doctoral Thesis / Mazalov L. – Brno : MENDELNET, 2013. – P. 758-763

14. European Convention for the Protection of Vertebrate Animals used for Experimental and

Other Scientific Purposes (Strasbourg, 18.III.1986) [Electronic resource]. – 2005. - Mode of access:


15. Методические рекомендации по оценке мясной продуктивности, качества мяса и подкожного жира свиней / ВАСХНИЛ, Совет по координации научно-исследовательских работ в области повышения качества продуктов животноводства. – Москва, 1987. – 64 с.

16. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research / R. Peakall [et al.] // Molecular Ecology Notes. – 2006. – Vol. 6. – P. 288-295.

17. Effects of porcine MC4R and LEPR polymorphisms, gender and Duroc sire line on economic traits in Duroc x Iberian crossbred pigs. Meat Science. – 2011. – Vol. 88. – P. 169-173. – Also: Munoz G., Alcazar E., Fernandez A., Barragan C., Carrasco A., de Pedro E., Silio L., Sanchez J.L., Rodriguez M.C.

УДК 636.4.082




–  –  –

Введение. Специализация селекции на данном этапе развития отрасли свиноводства неразрывно связана с массовым внедрением методов скрещивания и гибридизации. Только при наличии в системах разведения чётко выраженных отцовских и материнских форм, можно ожидать гетерозисный эффект от их сочетаний [1, 2]. Не случайно в странах с развитым свиноводством (Дания, Англия, Германия, Беларусь и др.) больше 80 % товарной свинины получают на гибридной основе, используя для этой цели специализированные генотипы свиней, отселекционированные по материнским и отцовским качествам [3, 4, 5]. Поэтому создание нового заводского типа в крупной белой породе в Украине с улучшенными откормочными качествами будет способствовать расширению общего количества специализированных генеалогических структур в составе внутрипородных типов – в данном случае в составе внутрипородного типа УКБ-2.

Целью работы стало расширение генеалогических структур внутрипородных типов крупной белой породы свиней за счёт создания в их составе новых заводских типов и таким образом способствовать расширению возможностей использования их в системах гибридизации.

Стандарт откормочных и мясных качеств заводского типа: уровень среднесуточных приростов от рождения – 550-580 г, толщина шпига на уровне 6-7 ребра – 21-23 мм.

Материалы и методы исследований. Селекционная программа по созданию заводского типа осуществляется в племзаводе ООО «Обрий»

Днепропетровской области. Заводское стадо входит в общее количество маточного поголовья, которого содержится в хозяйстве 1000 голов (поголовье племзавода – 300 основных свиноматок). Схема создания заводского типа приведена на рисунке 1.

–  –  –

Рисунок 1 – Схема создания нового заводского типа с улучшенными откормочными качествами в племзаводе «Обрий»

На данном этапе работы получены III и IV генерации животных.

В основу отбора положено оценку ремонтного молодняка по собственной продуктивности с прижизненным измерением толщины шпига.

Под контролем находятся также репродуктивные качества свиноматок, особенно показатели многоплодия.

Для ранжирования животных, после оценки, применяются оценочные индексы.

Для характеристики воспроизводительных качеств свиноматок:

I=A+2B+35G, где А – количество поросят при рождении, гол; В – количество поросят при отъеме, гол; G – среднесуточный прирост живой массы поросят до отъема, кг; 35 – постоянная величина [6].

Для ранжировки оцененного ремонтного молодняка:

I=100+(242K) – (4,13L), где 242; 4,13 – постоянные величины; К – среднесуточный прирост, кг;

L – толщина шпига, мм [7].

Животные племзавода находятся в составе трехступенчатой пирамиды, по которой осуществляется получение гибридного молодняка для откорма.

Результаты исследований. Для изучения воспроизводительных качеств свиноматок характеризовалась ведущая группа в разрезе семейств, от которых отбирается ремонтный молодняк (таблица 1).

–  –  –

Практически все семейства стада по репродуктивным качествам превышали требования класса элита. Это относится, прежде всего, к показателю многоплодия и массе гнезда в 2 месяца. В целом же по всему стаду многоплодие составило 11,0 поросят на опорос, при массе гнезда в 2 месяца – 207,2 кг. То есть уровень репродуктивных качеств маточного поголовья отвечает требованиям для материнских форм и их эффективно используют в системе гибридизации данного хозяйства.

Результаты оценки ремонтного молодняка по фенотипу (III – IV генерации) показаны в таблице 2.

–  –  –

Среднесуточные приросты зафиксированы от дня рождения молодняка и составляют в среднем при живой массе 100 кг 538 г. По среднесуточным приростам выделяются животные из семейства Чёрной Птички (581,8 г), Тайги (561,2 г), Рекламы (554,4 г). Им соответствует и величина оценочного индекса (от 130,1 до 140,8).

Однако у отдельных семейств, с недостаточно высокими среднесуточными приростами, например, семейство Сои, индекс составил 134 единицы, что выше среднего уровня (127,6). В этом случае свою роль в индексе сыграла меньшая толщина шпига. Таким образом, оценочный индекс будет наиболее высоким при условии, что высокий среднесуточный прирост и параллельно зафиксированная низкая толщина шпига. В таком случае, удерживая высокий уровень откормочных качеств, мы будем способствовать улучшению и мясных качеств ремонтного молодняка, снижая толщину шпига.

Заключение. Выполнение селекционной программы по созданию специализированного заводского типа с улучшенными откормочными качествами показало, что животные III и IV генераций приближаются к запланированным стандартам, однако следует уменьшить толщину шпига, доведя её в среднем до 21-23 мм, а среднесуточные приросты, от дня рождения, до 550-580 г.

Показатели воспроизводительных качеств находятся на достаточно высоком уровне, что дает основание использовать создаваемый заводской тип в качестве материнской формы (самостоятельно и в сочетании с другими породами.


1. Никитченко, И. Н. Гетерозис в свиноводстве / И. Н. Никитченко. – Л. : Агропромиздат, 1987. 215 с.

2. Овсянников, А. Что понимать под гибридизацией свиней / А. Овсянников // Свиноводство. – 1976. № 3. – С. 40-42.

3. Створення внутріпородних заводських типів свиней у великій білій породі з покращеними м’ясними якостями / М. Д. Березовський [та ін.] // Свинарство : міжвідомчий тематичний науковий збірник. – К., 2009. – Вип. 57. – С. 15-25.

4. Ващенко, П. А. Вивчити репродуктивні якості свиней великої білої породи у поєднанні з генотипами вітчизняної і зарубіжної селекції / П. А. Ващенко // Вісник Полтавської державної аграрної академії. – 2003. № 1-2. – С. 165-166.

5. Мороз, О. Г. Продуктивність свиноматок внутріпородного типу УВБ-1 у поєднанні з кнурами різних генотипів / О. Г. Мороз // Тваринництво України. – 2008. № 5. – С. 18-19.

6. Програма селекції великої білої породи свиней в Україні на 2003-2013 роки / М. Д.

Березовський [та ін.]. - К. : Міністерство аграрної політики України, 2004. – 104 с.

7. Тайлер, Б. Лекции по свиноводству / Б. Тайлер. – Самара, 1996. – 65 с.

УДК 636.4.082.453.53




Д.М. БОГДАНОВИЧ1, А.И. БУДЕВИЧ1, О.И. ГЛИВАНСКАЯ1, Ю.В. ЛОМАКО2, Л.А. АМОСОВА2 РУП «Научно-практический центр Национальной академии наук

–  –  –

Введение. За последнее десятилетие в странах с развитым свиноводством многие технологические процессы метода искусственного осеменения были существенно улучшены. Особенно большие достижения отмечены в технологии получения, разбавления и хранения половых гамет производителей. Сперму разбавляют с целью увеличения объема конечной спермопродукции и осеменения большего поголовья маток, поддержания генетически обусловленного уровня ее оплодотворяющей способности на протяжении всего срока хранения [1, 2].

Однако эякулят представляет собой благоприятную среду для роста и размножения микроорганизмов. Они выделяют продукты своей жизнедеятельности и токсины, которые снижают выживаемость и оплодотворяющую способность спермиев. Кроме того, в спермопродукции могут содержаться возбудители инфекционных болезней. При попадании в половые органы самок со спермой патогенные штаммы возбудителей в различных ассоциациях с другими микроорганизмами вызывают нарушения воспроизводительной функции.

Из разбавителей, применяющихся в республике, наиболее широко известным является глюкозо-хелато-цитрато-сульфатная среда (ГХЦСсреда), которая позволяет сохранять разбавленную сперму от трех до пяти дней. Для санации спермы хряков-производителей до настоящего времени применяли спермосан (пенициллин +стрептомицин + стрептоцид) и полиген (полимиксин + гентамицин), но в связи с вероятной токсичностью для спермиев некоторых серий компонентов этих препаратов их применение стало проблематичным. Кроме того, эффективность санирующих средств снижается в связи с увеличением количества штаммов резистентных микроорганизмов и их адаптации к действию антибиотика. За рубежом из целого ряда антибиотиков нашли применение цефтиофур, апрамицин и др.

[3], однако данные по эффективности их воздействия на патогенную микрофлору недостоверны и противоречивы, что требует проведения дополнительных исследований в направлении поиска оптимальных санирующих средств и их применения в технологии искусственного осеменения свиней.

Цель работы – изучить влияние новых видов антибиотиков на бактериальный состав эякулятов хряков-производителей.

Материалы и методы исследований. Исследования проводились в ГП «ЖодиноАгроПлемЭлита» Смолевичского района Минской области, лаборатории воспроизводства, трансплантации эмбрионов и трансгенеза животных РУП «Научно-практический центр Национальной академии наук Беларуси по животноводству» и РУП «Институт экспериментальной ветеринарии им. С.Н. Вышелесского».

Получение, оценка и разбавление спермы осуществлялись в соответствии с «Инструкцией по искусственному осеменению свиней» [4].

Чувствительность к антибиотикам выделенных микроорганизмов определялась при помощи анализатора Vitek Compact 2 (Франция) согласно инструкции, а также диско-диффузионным методом к следующим препаратам: бензилпенициллин, оксациллин, гентамицин, ципрофлоксацин, левофлоксацин, моксифлоксацин, эритромицин, клиндамицин, ванкомицин, тетрациклин, рифампицин, триметоприм/сульфометоксазол.

На поверхность агара в чашке Петри наносилась бактериальная суспензия, обычно эквивалентная стандарту мутности 0,5 по McFarland и затем помещалась по 5 дисков на чашку. Диффузия антибиотика в агар приводила к формированию зоны подавления роста микроорганизмов вокруг дисков. После инкубации чашек в термостате при температуре 35-37 С в течение 18-20 часов учитывали результат путем измерения диаметра зоны вокруг диска в миллиметрах.

При разбавлении спермы в глюкозо-хелато-цитратно-сульфатную среду добавляли следующие антибиотики: ампициллин, цефазолин, цефепим, цефотаксим, лефлокс, фурадонин в дозе 150, 200 и 250 мг на 1 литр разбавителя, гентамицин служил в качестве контроля.

Для определения эффективности действия вышеперечисленных антибиотиков на микрофлору разбавленной спермы проводили высев по 0,1 мл каждой пробы спермы на чашку с агаром с добавлением 5 % цельной крови от здоровых телят. После инкубации чашек в термостате при температуре 35-37 С в течение 18-20 часов подсчитывали количество колониеобразующих единиц (КОЕ) на каждой чашке. Для получения количества колоний в 1,0 мл умножали полученное число на 10. Выделенные культуры идентифицировали при помощи биохимического анализатора Vitek Compact 2.

Результаты исследований.

При проведении микробиологического исследования выделены следующие культуры микроорганизмов:

Escherichia coli. Принадлежность к виду устанавливали согласно типичному росту на среде Эндо и окраске по Граму. E. coli в среде Эндо росли в виде округлых гладких колоний с металлическим блеском, изменяя цвет среды на малиновый. В мазке, окрашенном по Граму, видны одиночные грамотрицательные палочки.

Micrococcus luteus/lytae. Принадлежность к виду устанавливали согласно биохимическому исследованию на анализаторе – Vitek Compact 2.

Вероятность – 94 %. Micrococcus luteus/lytae на кровяном агаре росли в виде средних сочных серо-желтых колоний. В мазке, окрашенном по Граму, одиночные и группами крупные грамположительные кокки.

Kocuria varians. Принадлежность к виду устанавливали согласно биохимическому исследованию на анализаторе – Vitek Compact 2. Вероятность – 95 %. Kocuria varians на кровяном агаре росли в виде мелких сероватых полупрозрачных колоний. В мазке, окрашенном по Граму, отмечаются одиночные и расположенные группами грамположительные кокки.

Streptococcus porcinus. Принадлежность к виду устанавливали согласно биохимическому исследованию на анализаторе – Vitek Compact 2.

Вероятность – 94 %. Streptococcus porcinus на кровяном агаре росли в виде мелких серо-белых округлых колоний, образуя зону В-гемолиза. В мазке, окрашенном по Граму, видны одиночные и группами грамположительные кокки.

Таким образом, данное исследование показало, что 12 (60 %) проб спермы не содержали микроорганизмов, в 6 (30 %) имелась Escherichia coli; в 4 (20 %) Micrococcus luteus/lytae; в 3 (15 %) Kocuria varians и в (5 %) Streptococcus porcinus. В некоторых пробах микроорганизмы присутствовали в комплексе.

С целью изучения влияния санирующих препаратов при разбавлении свежеполученной спермы хряков-производителей на видовой состав бактериальной флоры и определения чувствительности выделенных микроорганизмов к антибактериальным препаратам были отобраны 63 образца.

Результаты проведения исследований по ингибирующим свойствам различных антибиотиков представлены в таблице 1.

–  –  –

При анализе полученных данных можно отметить, что введение в состав разбавителя санирующих препаратов в дозе 150-200 мг на 1 литр не оказало эффективного воздействия на микрофлору. Так, в чашках с Kocuria varians наблюдался рост колоний от 20 до 130 единиц, с Streptococcus porcinus – от 80 до 150 единиц. При введении 250 мг на 1 л разбавителя практически не наблюдалось микробной контаминации спермы, особенно по сравнению с контролем. Наиболее положительным оказалось применение ампициллина, цефепима, цефотаксима и фурадонина.

Заключение. Установлено, что оптимальной дозировкой введения санирующего комплекса антибиотиков является добавление в синтетическую среду 250 мг ампициллина или цефепима, цефотаксима, фурадонина на 1 л разбавителя, в результате чего подавляется рост микроорганизмов Micrococcus luteus/lytae, Kocuria varians, Escherichia coli и Streptococcus porcinus.


1. Mitchell, H. The artificial insemination and Embryo transfer of dairy and beef cattle (including information pertaining to goats, sheep, horses, swine, and other animals) : A handbook and laboratory manual / H. Mitchell ; Doak. Interstate publishers, INC. – 1994. – 352 p.

2. Veterinary Reproduction & Obstetrics / H. A. Geoffrey [et al.]. – Seventh Edition. – W.B.

Saunders Company Ltd., 1996. – 726 р. – Also: Noakes D.E., Pearson H., Parkinson T.J.

3. Факторы патогенности Pasteurella multocida / А. П. Лемиш [и др.] // Эпизоотология, иммунобиология, фармакология, санитария. – 2009. – № 2. – С. 20-26. – Авт. также : Толяронок Т.Е., Амосова Л.А., Андрусевич А.С., Хралович Т.М.

4. Инструкция по искусственному осеменению свиней / Е. В. Раковец [и др.]. – Мн., 1998. – 38 с.

УДК 636.4.82




–  –  –

Введение. Интенсивность роста животных определяется наследственностью и условиями среды и обусловливает их продуктивность в зрелом возрасте. Она находится в тесной связи со скороспелостью, то есть является ее первопричиной. По мнению классиков зоотехнической науки [1, 2, 3], между скороспелыми и позднеспелые животными существуют значительные различия, как по морфофизиологическим показателям, так и по хозяйственно-полезным признакам.

Кулешов П.Н. [4] отмечал, что скороспелые животные отличаются от позднеспелых формами своего телосложения. Так, для скороспелых животных характерны следующие особенности: туловище широкое и объемное, голова и ноги короткие, грудь и спина широкие, ребра круто изогнутые. Он также подчеркивал, что скороспелость во многих случаях желаемое качество, так как скороспелые животные лучше оплачивают корм, чем позднеспелые. Основные отличия скороспелых свиней от позднеспелых – это раннее прорезывание зубов, преждевременное сращение эпифизов с диафизами и усиленное развитие жировой ткани и мышц.

В современном свиноводстве скороспелость животных определяется количеством дней, которые тратит молодняк от рождения до живой массы 100 кг. Более скороспелые свиньи обеспечивают быструю смену поколений, способствует ускорению селекционного процесса.

По данным В.Д. Кабанова [5], Л.П. Акимовой [6], В. Карапуз, С. Торской [7], высокая скорость роста негативно влияет на репродуктивные качества свиней. Но совершенно противоположную точку зрения имеют К.

Г. Кадыков [8], D. S. Buchanon, D. G. Mc Zaren, R. O. Bates [9], Ю. Ф.

Мельник, А. А. Волков, В. С. Топиха [10], в исследованиях которых животные с высокой скоростью роста имели лучшие показатели воспроизводительных и откормочных качеств.

Таким образом, вопросы изучения связи интенсивности роста с воспроизводительными качествами свиней являются до сегодняшнего дня актуальными, т. к. значительно влияют на рентабельность отрасли свиноводства.

Цель работы – установление влияния интенсивности роста на воспроизводительные качества свиноматок крупной белой породы заводского типа «Бахмутский».

Материалы и методика исследований. Исследования проводились на племзаводе ПрАО «Бахмутский Аграрный Союз» Артемовского района Донецкой области на свиноматках крупной белой породы.

Работа проводилась в соответствии с тематикой научных исследований Института свиноводства и АПВ НААН Украины (№ государственной регистрации 0111U114044).

Результаты исследований. Анализ опоросов свиноматок селекционного стада показал, что наиболее высокие показатели продуктивности получены от маток, у которых возраст достижения живой массы составлял 160-170 дней: живая масса маток после первого опороса была 184,9 кг, длина туловища – 146,0 см, многоплодие – 13,2 гол., масса гнезда – 209,9 кг. При уменьшении интенсивности роста при достижении живой массы 100 кг наблюдалась тенденция к ухудшению показателей развития и воспроизводительных качеств свиноматок: так, у маток, которые достигли живой массы 100 кг за 221-230 дней, живая масса была меньше на 4,3 кг, длина туловища – на 4,4 см, многоплодие – на 0,7 голов, масса гнезда в месяца – на 38,9 кг.

В настоящее время в селекционном стаде племзавода используются хряки венгерской селекции, поэтому значительный интерес представляют исследования, направленные на определение влияния этих производителей на интенсивность роста и воспроизводительные качества их дочерей.

Для этого нами были проведен сравнительный анализ влияния интенсивности роста свиней на продуктивные качества свиноматок заводского типа «Бахмутский» и сочетания свиноматок этого типа с хряками крупной белой породы венгерской селекции (таблицы 1 и 2).

Нами было установлено, что при использовании хряковпроизводителей венгерской селекции произошло увеличение возраста достижения живой массы 100 кг в стаде на 7,6 дней. Результаты наших исследований свидетельствуют, что возраст первого опороса у маток заводского типа и сочетания ЗТ КБП х КБП венгерской селекции почти одинаковый – 11,8-12,1 месяцев. По показателям развития значительной разницы в изучаемые периоды не наблюдалось, но в среднем толщина шпика была меньше у животных заводского типа на 0,6 мм.

По воспроизводительным качествам значительное преимущество имели животные заводского типа: размах варьирования показателя многоплодия составил 0,8 голов и находился в пределах от 12,3 до 13,1 голов, тогда как у маток с наследственностью 50 % венгерской селекции аналогичные данные были 10 голов и 11,4-12,4 гол. Границы варьирования показателя массы гнезда представляли для маток заводского типа 193,1-218,3 кг, а в сочетании с хряками венгерской селекции – 149,2-199,8 кг.

Проведенный корреляционный анализ позволил установить достоверные зависимости между возрастом первого опороса и живой массой и длиной туловища (соответственно r = 0,53 и 0,45); между возрастом достижения живой массы 100 кг и показателями развития установлены невысокие, но достоверные зависимости (r = -0,17 и -0,25), которые необходимо учитывать при отборе молодняка.

Заключение. Исследования показали, что оптимальным возрастом достижения живой массы 100 кг является 160-170 дней, именно эта интенсивность роста способствует получению высоких показателей продуктивности свиноматок.

46 Литература

1. Богданов, Е. А. Общезоотехнические основы экстерьера / Е. А. Богданов. – М.Петербург : Госиздат, 1923. – 311 с.

2. Чирвинский, Н. П. Избранные сочинения: в двух томах / Н. П. Чирвинский. – М. :

Сельхозгиз, 1949–1951.

3. Малигонов, А. А. Избранные труды / А. А. Малигонов. – М. : Колос, 1968. – 391 с.

4. Кулешов, П. Н. Свиноводство / П. Н. Кулешов. – М.-Л. : Сельхозгиз, 1930. – 192 с.

5. Кабанов, В. Д. Рост и мясные качества свиней / В. Д. Кабанов. – М. : Колос, 1972. – 191 с.

6. Акимова, Л. П. Продуктивность свиней различных типов конституции / Л. П. Акимова // Свиноводство. – 1987. – № 1. – С. 32-33.

7. Карапуз, В. Інтенсивність формування ремонтних свинок / В. Карапуз, С. Торська // Тваринництво України. – 1997. – № 5. – С. 10.

8. Кадыков, К. Г. Энергия роста племенного молодняка и продуктивные качества свиней / К. Г. Кадыков // Науч. тр. Донского СХИ. – пос. Персиановский, 1976. – Т. 11, вып. 3. – С.


9. Buchanan, D. S. Characterization of rapid and slow grooving seines of pigs / D. S. Buchanan, D. C. Mc Laren, R. O. Bates // Oklahoma Agricultural Experiment Station Animal Research Report. – 1984. – Vol. 116. – S. 1-3.

10. Мельник, Ю. Ф. Шляхи ефективного ведення галузі свинарства в Україні / Ю. Ф.

Мельник, А. А. Волков, В. С. Топіха // Вісник Аграрної науки Причорномор’я. – 2002. – Вип.

3(17). – С.173-177.

УДК 636.




–  –  –

Введение. Межпородное скрещивание и гибридизация, как высшая форма племенной работы, является быстрым и эффективным способом повышения производительности свиней. Они позволяют наиболее полно использовать лучшие генотипы отечественных и зарубежных пород.

Биологическая сущность скрещивания заключается в обогащении и расширении наследственной основы вследствие высокой гетерозиготности, лучшего приспособления животных к условиям содержания. Успех скрещивания зависит от умелого подбора исходных пород, цели и вида скрещивания, подбора лучших производителей. Но, как показала практика, в современных условиях скрещивание исчерпало свои потенциальные возможности. В связи с этим перед учеными возникла задача разработать новые, более эффективные методы, способные обеспечить значительное повышение производительности свиней и улучшения качества продукции [1-4].

Целью работы было изучение наиболее удачных сочетаний свиней разных генотипов.

Методика исследований. Для изучения влияния межпородного скрещивания и гибридизации на откормочные качества молодняка свиней было сформировано 3 группы.

При формировании групп в качестве материнской во всех группах были свиноматки крупной белой породы (КБ), в ІІІ группе – молодняк, полученный от чистопородного сочетание, в I группе – от хряков породы ландрас, во II группе – дюрок. Внутри каждой группы шло разделение и по линиям. В течение откорма молодняка использовали комбикорма СКи СК-31.

Результаты исследований. В последнее время значительное внимание уделяется использованию хряков породы дюроки ландрасдля промышленного скрещивания со свиноматками разных пород. Повышенный интерес к животным мясных пород в большинстве своем связан с их высокими показателями, которые характеризуют отличное развитие, высокую скороспелость интенсивность роста, оплату корма приростами, убойные и мясные качества.

В таблице 1 приведены данные откормочных качеств свиней породнолинейных сочетаний в среднем по линиям и породам сравнении с чистопородным разведением свиней крупной белой породы.

–  –  –

Анализ результатов контрольного откорма поместных и чистопородных подсвинков свидетельствует о том, что наилучшие откормочные качества имели двухпородные помеси.

Живой массы 100 кг они достигали на 13,6-14,6 дня раньше, а их среднесуточный прирост превышал на 39 г, или на 6,9 % (Р0,95), при меньшей затрате корма на 1 кг прироста на 0,13 к. ед., или на 3,7 %. При этом интенсивность роста поместных животных от хряков пород ландраси дюрокбыл практически на одном уровне.

Одной из форм повышения производительности товарного свиноводства есть межпородное скрещивание, эффективность которого зависит от сочетаемости генотипов, уровня кормления и условий содержания. Сочетаемость отражает эффект гетерозиса.

Изучая рост и развитие молодняка свиней разных генотипов, которые получены с использованием внутрипородного отбора и скрещивания, установлено, что порода дюрокв системах гибридизации позволяет получать более скороспелый молодняк для откорма в условиях промышленной технологии.

Мясные качества свиней разных породно-линейных сочетаний в среднем по линиям и породам в сравнении с чистопородным разведением крупной белой породы предоставлены в таблице 2.

–  –  –

Анализ результатов контрольного откорма поместных и чистопородных подсвинков свидетельствует о том, что наилучшие откормочные качества имели двухпородные помеси.

У этих животных масса окорока была более высокой на 0,7-0,8 кг, а толщина шпику над 6-7 грудными позвонками – меньшей на 40-0,9 мм, чем у чистопородного молодняка, или на 0,6-1,3 мм. На последнем месте по мясным качествам были чистопородные животные крупной белой породы.

Единственно верный путь отбора животных это проведение селекции по комплексу признаков методом селекционных индексов, которые позволяют оценить генотип животного, как с зоотехнической так и с экономической точек зрения, поскольку признаки свиней имеют разное биологическое и экономическое значение и наследуются неодинаково. Индексный метод позволяет одновременно совершенствовать целый комплекс признаков и в первую очередь те, которые действительно определяют как количественную, так и качественную стороны развитияотрасли.

Суть метода селекционных индексов заключается в том, что недостаток одного признака у животного компенсируется преимуществом другим, в результате чего экономический эффект селекционной работы какой-то популяции значительно повышается.

В таблице 3 приведены обобщенные данные о селекционных индексах откормочных и мясных качеств свиней в среднем по линиям и разным породным сочетанием. При этом расчеты велись в двух вариантах с применением формул(І100 ІВМ).

–  –  –

Проведенные исследования свидетельствуют о существенном влиянии генотипа животных на селекционные показатели – откормочные и мясные качества молодняка свиней и большую вариабельность между породными и породно-линейными сочетаниями.

Как видно из таблицы 3, лучшими сочетания определены двухпородные от свиноматок крупной белой породы с хряками пород ландрас и дюрокКБ х Л (2 ранг) и КБ хД (1 ранг). На последнем месте был вариант чистопородного разведениякрупной белой породы (3 ранг).

Таким образом, использование нового индексного метода позволяет определить лучшие породные сочетания, которые дают возможность увеличивать продуктивность стада, потому что этот метод раскрывает генетическую и биологическую суть явлений высокой продуктивности животных.

Заключение. Определив селекционно-генетические параметры, в том числе и селекционный индекс, селекционер имеет возможность высчитать ожидаемый эффект селекции и применять более обоснованные методы отбора и подбора.


1. Березовський, М. Ефективність використання оцінених кнурів порівняно з міжпородним схрещуванням / М. Березовський, Н. Горбачова // Тваринництво України. – 2003. – № 4.

– С. 22.

2. Жила, Е. В. Откормочные и мясные качества подсвинков / Е. В. Жила, Э. В. Костылев // Актуальные проблемы производства свинины в Российской Федерации : материалы 12-го заседания межвуз. коорд. совещ. по свиноводству и респ. науч.-произв. конф. – пос. Персиановский : Донской ГАУ, 2003. – С. 45-46.

3. Рыбалко, В. П. Откормочные и мясные качества свиней разводимых в Украине генотипов / В. П. Рыбалко, В. М. Нагаевич, В. И. Герасимов // Повышение продуктивности сельскохозяйственных животных : сб. науч. тр. – Харьков, 2005. – С. 168-172.

4. Хохлов, А. М. Двух- и трехлинейные сочетания их использования в селекции / A. M.

Хохлов // Свиноводство. – 2006. – № 5. – С. 4-5.

УДК 636.4.082.2



–  –  –

Введение. Как свидетельствуют отечественная и зарубежная прак-тика, решение мясной проблемы немыслимо без интенсивного раз-вития свиноводства – одной из наиболее скороспелых и эффективных отраслей животноводства. При этом интенсификация его должна осу-ществляться не только стабильным обеспечением животных доста-точным количеством полноценных кормов и применением прогрес-сивных технологий содержания, но и совершенствованием племенной работы на основе современных достижений селекции и генетики [1, 2, 3].

Рентабельность производство свинины в значительной степени определяются эффективностью использования свиноматок, поэтому многоплодие в производстве высококачественной свинины имеет первостепенное значение, но этот признак является трудным для совершенствования, так как наследственно низко обусловлен (h2=0,08-0,23). При использовании хряков специализированных мясных пород существует вероятность ослабления репродуктивных способностей маток генетически отдалённых пород [4].

При разведении свиней, особенно в последнее время, все чаще стали отдавать предпочтение раздельной селекции по ограниченному количеству отдельных хозяйственно полезных признаков, специали-зации пород, типов и линий на материнские и отцовские формы с последующим их скрещиванием и выявлением наиболее эффективных кроссов для практического использования. Как показали специальные исследования и наблюдения, эффективность внутрипородной селек-ции, умелое сочетание генотипов при гибридизации и скрещивания способствует повышению многоплодия маток на 5-7 %, скороспелости молодняка – на 12-17 %, снижению затрат кормов на 5-10 % и увеличению выхода мяса в туше на 3-5 % [5, 6, 7].

Целью работы являлось сравнительное изучение репродуктивных, откормочных и мясных качеств при чистопородном разведении и в кроссах для более эффективного распространения лучших сочетаний в системе разведения.

Материалы и методы исследований. Научно-производственный опыт проводился на Государственном Предприятии по Исследованию в Селекции и Гибридизации Свиней «Молдсуингибрид» (г. Орхей).

Подопытные животные кормились по рационам, принятым на предприятии разработанных по нормам ВИЖ и Полтавского НИИ свиноводства.

Продуктивность маток оценивали после получения от них опоросов по следующим показателям: многоплодия, масса гнезда при отъёме в 35 дней и средняя масса одной головы.

Для контрольного откорма отбирались подсвинки по 12 голов в 85-95дневном возрасте со средней живой массой 25-30 кг [8].

Откормочные и мясные качества молодняка изучали по резуль-татам контрольного откорма и убоя.

У подопытных животных определяли следующие показатели: воз-раст достижения 100 кг, среднесуточный прирост и затрата корма на 1 кг прироста.

После окончания контрольного откорма свиней забивали и прово-дили определения длины туши, толщину шпика над 6-7 грудными поз-вонками, масса заднего окорока и площадь «мышечного глазка».

Результаты исследований. В наших исследованиях изучались сочетания хряков мясных пород дюрок, пьетрен, гемпшир с материн-скими ландрас и йоркшир при двух- и трёхпородном скрещивании, а также двухпородных свиноматок с двухпородными хряками на репро-дуктивные признаки свиноматок. Установлено, что среди изученных сочетаний наиболее высокими показателями репродуктивных приз-наков отличались свиноматки породы йоркшир, осеменённые хряками породы ландрас, и свиноматки породы ландрас при скрещивании с хряками йоркшир, у которых многоплодие составило соответственно 10,7-10,9 голов, в т. ч. живых – 10,7-10,6, молочность – 48,7-49,6 кг, масса гнезда при отъёме в 35 дней – 89,3-88,3 кг.

У маток пород ландрас и йоркшир при чистопородном разведении соответствующие показатели репродуктивных качеств были несколько ниже (многоплодие – 10,7-10,8 голов, в т. ч. живых – 10,6-10,4, молочность – 47,9-48,6 кг, масса гнезда при отъёме – 87,2-83,4 кг).

У помесных свиноматок материнских пород при скрещивании с хряками отцовских пород (дюрок, пьетрен, гемпшир) аналогичные показатели имели наиболее низкое значение относительно всех изучаемых сочетаний.

При скрещивании двухпородных свиноматок пьетрен х дюрок, пьетрен х йоркшир, дюрок х гемпшир и дюрок х ландрас с хряками материнских пород ландрас и йоркшир лучшие результаты по репродуктивным признакам получены при трёхпородном скрещивании свиноматок дюрок х ландрас с хряками йоркшир и пьетрен х дюрок с хряками ландрас.

В наших исследованиях при изучении откормочной продуктивности двух-, трёх- и четырёхпородного гибридного молодняка по сравнению с чистопородым разведением установлено, что лучшими пока-зателями откормочных признаков отличались гибриды (йоркшир х дюрок) х (ландрас х пьетрен) и (пьетрен х дюрок) х ландрас, у которых возраст достижения живой массы 100 кг составил 170,0-179,1 суток, среднесуточный прирост живой массы – 754-722 г и затраты корма на 1 кг прироста – 3,22-3,37 к.

ед. В данных сочетаниях проявился гетерозис по возрасту достижения живой массы 100 кг на 1,4-3,2 % (p0,01).

У молодняка мясных пород пьетрен, гемпшир показатели откормочных признаков оказались несколько выше по сравнению со сверстниками материнских пород, где возраст достижения живой массы 100 кг составил 182,0-182,6 дней, среднесуточный прирост – 718,0-724,4 г и затраты на 1 кг прироста – 3,33-3,42 к. ед.

Опыт отечественного и мирового свиноводства показывает, что большое влияние на качество туш оказывает генотип животных [9, 10]. Мясные качества наследуются, как правило, промежуточно и характеризуются достаточно высокой степенью наследуемости [11, 12].

В связи с этим, в последние десятилетия в мире для получения постной свинины нередко используются в скрещивании хряки пород пьетрен и дюрок.

В наших исследованиях установлено, что наиболее высокими показателями мясных признаков среди сравнительных сочетаний отлича-лись гибриды (ландрас х дюрок) х пьетрен и (йоркшир х пьетрен) х дюрок при сравнении с чистопородными животными пьетрен, дюрок, ландрас и йоркшир.

Полученные результаты свидетельствуют, что использование в двух-, трёх- и четырёхпородном скрещивании чистопородных и гибридных хряков специализированных мясных пород на двух породных матках, по сравнению с чистопородными сверстниками наблюдались увеличения откормочных и мясных качеств.

Заключение. Выявлена высокая комбинационная способность по репродуктивным признакам при скрещивании свиноматок и хряков пород ландрас и йоркшир, а также двух породных свиноматок (пьетрен х дюрок) с хряками ландрас и йоркшир.

Доказано, что лучшими по откормочным признакам среди испытуемых сочетаний оказались четырёхпородные гибриды (йоркшир х дюрок х ландрас х пьетрен) и (пьетрен х дюрок х ландрас).

Установлено превосходство гибридного молодняка (йоркшир х дюрок х ландрас х пьетрен) и (пьетрен х дюрок х ландрас) над сверстниками чистопородных животных по мясным качествам.


1. Программа селекционно-племенной работы в свиноводстве Республики Молдова. – Орхей, 1992.

2. Гуменный, М. Ф. Программа селекционно-племенной работы в Республике Молдова / М. Ф. Гуменный // Эффективность селекционно-племенной работы и технологии производства продуктов свиноводства. – Кишинёв, 1993.

3. Traian Stan. Tehnologiia creterii suinelor. – Iai, 1992. – 363 p.

4. Beri, L. Genetica i ameliorarea suinelor / L. Beri, M. Stoica ; Ed. Ceres. – Bucureti, 1984.

5. Гучь, Ф. Использование мясных типов хряков в системе гибридизации / Ф. Гучь, И.

Доника. – Кишинев,1987. – 4 с.

Pages:     | 1 || 3 | 4 |   ...   | 19 |

Похожие работы:

«Министерство сельского хозяйства Российской Федерации ФГБОУ ВО «Красноярский государственный аграрный университет» ИННОВАЦИОННЫЕ ТЕНДЕНЦИИ РАЗВИТИЯ РОССИЙСКОЙ НАУКИ Материалы VIII Международной научно-практической конференции молодых ученых Красноярск УДК 001.1 ББК 65. И Редакционная коллегия: Антонова Н.В., доцент, директор Института международного менджмента и образования Красноярского ГАУ Бакшеева С.С., д.б.н., доцент, и.о. директора Института подготовки кадров высшей квалификации...»

«УДК 639.1:574 Состояние среды обитания и фауна охотничьих животных Евразии. Материалы IV Всероссийской научно-практической конференции «Состояние среды обитания и фауна охотничьих животных России» и I Международной научно-практической конференции «Состояние среды обитания и фауна охотничьих животных Евразии», Москва 18-19 февраля 2010 г. / ФГОУ ВПО «Российский государственный аграрный заочный университет», ФГОУ ВПО «Иркутская сельскохозяйственная академия», Ассоциация Росохотрыболовсоюз,...»

«Министерство сельского хозяйства РФ Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования Иркутская государственная сельскохозяйственная академия Материалы Международной научно-практической конференции молодых учных «НАУЧНЫЕ ИССЛЕДОВАНИЯ И РАЗРАБОТКИ К ВНЕДРЕНИЮ В АПК» (17-18 апреля 2013 г.) Часть II ИРКУТСК, 201 УДК 63:001 ББК 4 Н 347 Научные исследования и разработки к внедрению в АПК: Материалы Международной научно-практической конференции...»

«Министерство сельского хозяйства Российской Федерации Федеральное государственное бюджетное образовательное учреждение высшего образования Иркутский государственный аграрный университет имени А.А. Ежевского Совет молодых ученых и студентов ИрГАУ НАУЧНЫЕ ИССЛЕДОВАНИЯ СТУДЕНТОВ В РЕШЕНИИ АКТУАЛЬНЫХ ПРОБЛЕМ АПК Материалы региональной студенческой научно-практической конференции с международным участием, посвященной 70-летию Победы в Великой Отечественной войне и 100-летию со Дня рождения А.А....»


«ИННОВАЦИОННЫЙ ЦЕНТР РАЗВИТИЯ ОБРАЗОВАНИЯ И НАУКИ INNOVATIVE DEVELOPMENT CENTER OF EDUCATION AND SCIENCE О ВОПРОСАХ И ПРОБЛЕМАХ СОВРЕМЕННЫХ СЕЛЬСКОХОЗЯЙСТВЕННЫХ НАУК Выпуск II Сборник научных трудов по итогам международной научно-практической конференции (6 июля 2015г.) г. Челябинск 2015 г. УДК 63(06) ББК 4я43 О вопросах и проблемах современных сельскохозяйственных наук / Сборник научных трудов по итогам международной научно-практической конференции. № 2. Челябинск, 2015. 22 с. Редакционная...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «КУБАНСКИЙ ГОСУДАРСТВЕННЫЙ АГРАРНЫЙ УНИВЕРСИТЕТ» СТРАТЕГИЯ РАЗВИТИЯ СОВРЕМЕННОЙ ЭКОНОМИЧЕСКОЙ НАУКИ В УСЛОВИЯХ ГЛОБАЛИЗАЦИИ И ТРАНСФОРМАЦИИ ЭКОНОМИКИ Сборник статей по материалам III международной научно-практической конференции 30 апреля 2015 года Краснодар КубГАУ МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное...»

«Министерство сельского хозяйства Российской Федерации Министерство образования Республики Башкортостан Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «Башкирский государственный аграрный университет» Совет молодых ученых университета СТУДЕНТ И АГРАРНАЯ НАУКА Материалы VI Всероссийской студенческой конференции (28-29 марта 2012 г.) Уфа Башкирский ГАУ УДК 63 ББК 4 С 75 Ответственный за выпуск: председатель совета молодых ученых, канд. экон....»


«Министерство сельского хозяйства Российской Федерации Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «Пермская государственная сельскохозяйственная академия имени академика Д.Н. Прянишникова»МОЛОДЕЖНАЯ НАУКА 2015: ТЕХНОЛОГИИ, ИННОВАЦИИ Материалы Всероссийской научно-практической конференции молодых ученых, аспирантов и студентов, посвященной 85-летию основания ФГБОУ ВПО Пермская ГСХА и 150-летию со дня рождения Д.Н. Прянишникова (Пермь,...»


«Министерство сельского хозяйства Российской Федерации Федеральное государственное бюджетное образовательное учреждение высшего образования Иркутский государственный аграрный университет им. А.А. Ежевского НАУЧНЫЕ ИССЛЕДОВАНИЯ СТУДЕНТОВ В РЕШЕНИИ АКТУАЛЬНЫХ ПРОБЛЕМ АПК Материалы региональной студенческой научно-практической конференции с международным участием, посвященной 70-летию Победы в Великой Отечественной войне и 100-летию со Дня рождения А.А. Ежевского (25-26 марта 2015 года) Часть III...»


«Министерство сельского хозяйства Российской Федерации Министерство сельского хозяйства Республики Башкортостан ФГБОУ ВПО «Башкирский государственный аграрный университет» ООО «Башкирская выставочная компания» АГРАРНАЯ НАУКА В ИННОВАЦИОННОМ РАЗВИТИИ АПК МАТЕРИАЛЫ МЕЖДУНАРОДНОЙ НАУЧНО-ПРАКТИЧЕСКОЙ КОНФЕРЕНЦИИ, ПОСВЯЩЁННОЙ 85-ЛЕТИЮ БАШКИРСКОГО ГОСУДАРСТВЕННОГО АГРАРНОГО УНИВЕРСИТЕТА, В РАМКАХ XXV МЕЖДУНАРОДНОЙ СПЕЦИАЛИЗИРОВАННОЙ ВЫСТАВКИ «АГРОКОМПЛЕКС–2015» 1719 марта 2015 г. Часть III АКТУАЛЬНЫЕ...»



«Министерство сельского хозяйства Российской Федерации Департамент научно-технологической политики и образования Федеральное государственное бюджетное образовательное учреждение высшего образования «Красноярский государственный аграрный университет» СТУДЕНЧЕСКАЯ НАУКА ВЗГЛЯД В БУДУЩЕЕ Материалы Х Всероссийской студенческой научной конференции (2 апреля 2015 г.) Часть Секция 1. СОЦИАЛЬНО-ЭКОНОМИЧЕСКИЕ ПРОБЛЕМЫ РАЗВИТИЯ АПК РЕГИОНОВ РОССИИ Секция 2. СОВРЕМЕННЫЕ ПРОБЛЕМЫ НАУКИ (НА АНГЛИЙСКОМ ЯЗЫКЕ)...»

«Министерство сельского хозяйства Российской Федерации Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «Пермская государственная сельскохозяйственная академия имени академика Д.Н. Прянишникова»МОЛОДЕЖНАЯ НАУКА 2014: ТЕХНОЛОГИИ, ИННОВАЦИИ Материалы Всероссийской научно-практической конференции, молодых ученых, аспирантов и студентов (Пермь, 11-14 марта 2014 года) Часть Пермь ИПЦ «Прокростъ» УДК 374. ББК М Научная редколлегия: Ю.Н. Зубарев,...»

«Федеральное агентство научных организаций России Отделение сельскохозяйственных наук РАН ФГБНУ «Прикаспийский научно-исследовательский институт аридного земледелия» Региональный Фонд «Аграрный университетский комплекс» Актуальные вопросы развития аграрной науки в современных экономических условиях материалы IV-ой Международной научно-практической конференции молодых учёных 22-23 мая 2015 года (растениеводство, земледелие, овощеводство, садоводство) ФГБНУ «ПНИИАЗ», 2015 г. Актуальные вопросы...»


2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.