БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции

Pages:     | 1 | 2 || 4 | 5 |   ...   | 16 |

«НАУЧНО-ТЕХНИЧЕСКИЙ ПРОГРЕСС В СЕЛЬСКОХОЗЯЙСТВЕННОМ ПРОИЗВОДСТВЕ СБОРНИК ДОКЛАДОВ X Международной научно-практической конференции молодых ученых 16-17 апреля 2015 года, Великие Луки ...»

-- [ Страница 3 ] --

2. Джафаров, Новруз Муса­оглы. Эффективное использование высокобелковых растительных кормов в рационах молочных коров: диссертация … канд. с. х. наук: 06.02.02 [Электронный ресурс] / Новруз Муса­оглы Джафаров. – Ставрополь, 1998. – 134 с. Режим доступа: http://www.dissercat.com/content (30.01.2015).

3. Захаров Л.М. Качество молока голштинских коров при введении в рацион кормления глютена кукурузного // Вклад молодых ученых в инновационное развитие АПК России: Сборник материалов Всероссийской научно­практической конференции 23­24 октября 2014 г.­ Т. II. Производство и переработка продукции АПК; механизация процессов производства и переработки сельскохозяйственной продукции;

проектирование, ремонт и эксплуатация машин и оборудования; гуманитарные науки. – Пенза: РИО ПГСХА, 2014. – С. 62 – 64.

4. Харитонов, Е. Л. Анализ кормовых рационов для высокопродуктивного молочного скота различных регионов страны [Текст] / Е. Л. Харитонов //Молочное и мясное скотоводство. – 2012. ­ №4.­ С. 11­15.

Трифанов А.В., Белов А.А. Институт агроинженерных и экологических проблем сельскохозяйственного производства, г. Санкт-Петербург, Россйская Федерация


Промышленное производство крольчатины предусматривает содержание кроликов в закрытых помещениях с регулируемым микроклиматом и с механизацией основных процессов (Рисунок 1, а).

Благодаря сокращению затрат рабочего времени на кормление, поение и уборку навоза удалось добиться увеличения нагрузки на обслуживающий персонал. В крольчатнике на одного работника приходится 300 самок основного стада, в то время как в шеде этот показатель в 4 раза меньше. Регулируемый микроклимат позволил планировать окролы в течение всего года, в то время как при наружноклеточном способе содержания или содержание в шедах, окролы в морозной период не проводят. В крольчатниках, за год получают по 7­8 окролов в год, а это практически в два раза больше, чем при любом другом способе содержания. [1,2] а б Рисунок 1 ­ Крольчатник Благодаря регулируемому микроклимату фактор сезонности устранён и для получения наибольшей прибыли случку проводят в течение всего года. Наиболее популярный принцип промышленного выращивания кроликов называется «пусто – занято». Он заключается в размещении родительского поголовья в одном здании и перемещении его в другое здание здании после завершения цикла. Все кроликоматки одновременно искусственно осеменяются, через 14 дней производится пальпация, через 31 день все кролятся в течение одного дня. По прошествии 11 дней после окрола крольчихи осеменяются вторично. Через 25 дней они осеменяются перемещаются в соседнее здание в подготовленные для окрола отделения. Ещё через 5 дней происходит второй окрол, на 11 день – очередное осеменение и через 25 дней – перемещение [3].

Кролики от первого окрола, находящиеся в первом здании на откорме и выросшие за 76 первом дней, отправляются на бойню, освобождая место крольчихам для третьего окрола. Перед этим здание тщательно чистится, подвергается дезинфекции, мойке, сушке, то есть готовится к возвращению крольчих. Второй окрол забивается через 42 дня. Таким образом, происходит забивается цикл промышленного выращивания животных [3].

мышленного В крольчатнике одно­, двух, трёхъярусные сетчатые батареи установлены в несколько, двух­, рядов, с технологическим проходом между ними. Каждая клетка батареи, в которой содержится крольчиха, оснащена открытым гнездовым ящиком, для создания благоприятных держится условий для выращивания новорождённых крольчат (Рисунок 1, б я б).

Сетчатые батареи, в зависимости от нужд заказчика, комплектуются поплавковыми либо ниппельными поилками (Рисунок 2). Последние используются чаще всего т.к.

( ).

исключается проливание жидкости, её испарение и вода в поилке всегда остаётся чистой.

Рисунок 2 ­ Ниппельная (слева) и поплавковая (справа) поилки

Использование гранулированного комбикорма позволило механ механизировать процесс кормления кроликов, сбалансировать рацион по всем необходимым питательным веществам в соответствии с физиологическими потребностями. Для раздачи гранулированного корма применяется кормораздаточная линия, используемая в птичниках ( (Рисунок 3). Линия представляет собой кормопровод, состоящий из труб и находящегося в них гибкого шнека или спирали. Соединённые между собой трубы являются «трассой», по которой с помощью вращающего шнека/спирали корм перемещается от бункера к концу кормопровода. По всей длине кормопровода в трубах сделаны отверстия для выдачи корма в бункерные кормушки, установленные под этими отверстиями. В конце линии кормопровода установлена концевая кормушка, отличающаяся от остальных кормушек тем, что в ней установлено устрой устройство, отключающее привод при запо заполнении концевой кормушки кормом [4,5]..

Рисунок 3 ­ Линия кормления кроликов

Под клетками расположены навозные каналы, куда через сетчатый пол клетки проваливается помет, убираемый скребковым транспортёром (Рисунок 4 4). Вместо скребкового транспортёра можно использовать ленту, уложенную на дно канала, которая по мере накопления навоза вытягивается из здания при помощи наматывателей или автомобиля/трактора [6].

Рисунок 4 ­ Скрепер

Воздухообмен в крольчатниках осуществляется с помощью принудительной системы вентиляции, обеспечивающей приток свежего воздуха в помещение. В помещениях используют два вида вентиляции ­ приточную и вытяжную. Приточная вентиляция подаёт атмосферный воздух через вентиляторы. Благодаря избыточному давлению в помещении за счёт поступившего воздуха отработанный воздух спонтанно вытесняется. При работе вытяжной вентиляции наблюдается обратное явление ­ за счёт принудительной вытяжки воздуха в помещении создаётся пониженное давление, что влечёт спонтанное втягивание внутрь атмосферного воздуха. [7] Обогрев помещения осуществляется калориферами, совмещёнными с вентиляцией.

Для обеспечения правильной организации ветеринарной работы, соблюдения ветеринарно­санитарных требований по уходу и содержанию животных на фермах предусматривают следующие объекты: ветеринарно­санитарный пропускник, дезинфекционный барьер, ветеринарный пункт, убойно­санитарный пункт, окно для передачи кроликов, площадка для механической мойки и дезинфекции гнездовых ящиков и внутрифермских транспортных средств [7].


1. Балакирев Н.А., Тинаева Е.А., Тинаев Н.И., Шумилина Н.Н.Кролиководство [Текст]/Под ред.

Балакирева Н.А. – М.: КолосС, 2007. – 232 с. – (Учебники и учебные пособия для студентов высших учебных заведений.)

2. Белов А.А., Трифанов А.В. Кролиководство: Способы содержания.// Сборник научных трудов Всероссийского научно­исследовательского института овцеводства и козоводства. 2013. Т. 3. № 6. С. 372­375.

3. Кролики и кролиководство http://mnogo­krolikov.ru/razvedenie­krolikov/krolikovodstvo­kak­ biznes

4. Напольное содержание – Уралтехномаш Плюс http://www.utm­plus.ru/info­05­napolnoe­ soderzhanie

5. Петенко А.И., Жолобова И.С., Ющенко А.И., Якубенко Е.В., Гнеуш А.Н. Ветеринарно­ санитарные аспекты выращивания кроликов при применении абсорбентно­пробиоти ческого препарата «ОРГАНИК СБА».// Ветеринария Кубани.­2014.­С. 8­10.

6. Группа компаний “Valmont Agro” http://www.valagro.ru/krolikoferma/

7. Кролики http://allrabbit.ru/content/view/430/32/ Усенбеков Е.С., Иманбаев А.А., Сиябеков С.Т. Казахский национальный аграрный университет, г Алматы, Республика Казахстан



Интродукция вредных мутаций как следствие миграции генов из одной популяции в другие при импорте и использовании племенного материала в товарных и племенных хозяйствах ­ один из главных факторов появления так называемых «новых» форм патологии.

Исследованиями ученых установлено, что в результате использования спермы быков­ производителей гетерозиготных по генетическим дефектам отмечается тенденция повышения эмбриональной смертности у коров [1,2].

Учеными проведена ПЦР диагностика эмбрионов коров на выявление DUMPS. Ооциты коров с известным генотипом, т.е. носителей мутации гена UMP оплодотворяли в условиях in vitro спермой быка гетерозиготного носителя. Дальнейшее изучение развития эмбрионов, показывает, что большинство эмбрионов подвергались дегенерации и не дошли стадии морулы и бластоцисты, так как они являются гомозиготными и гетерозиготными носителями генетического дефекта DUMPS. Таким образом, экспериментальным путем доказана роль мутации гена UMP в этиологии эмбриональной смертности у коров [4].

Зарубежные ученые эмбриональную смертность рассматривают в качестве одной из основных причин репродуктивных проблем у крупного рогатого скота, приводящих в результате к снижению показателей стельности. Известно, что показатели оплодотворяемости обычно составляют 90%, а эмбриональная смертность является причиной 29­39% потерь после оплодотворения, большинство из которых (приблизительно 70­80%) происходит между 8 и 16­м днем после оплодотворения [3].

Материалы и методы исследования. Опыты по изучению влияния точечной мутации гена CD 18 на воспроизводительные функции коров проводили в хозяйстве ТОО «KazBeef Ltd» Енбекшилдерского района Акмолинской области. Нами в течение 2012­2014 гг проведена аттестация быков­производителей АО «Асыл­Тулик» и ТОО «Асыл» в количестве 110 голов, выявлен один бык­производитель – гетерозиготный носитель BLAD (BL), кличка Winston. Замороженная сперма данного быка­производителя была использована в хозяйстве ТОО «KazBeef Ltd» для осеменения коров. Анализ результатов искусственного осеменения коров спермой гетерозиготного быка­производителя по локусу BLAD показывает, что из коров 39 голов имели более двухкратное осеменение, индекс осеменения составил 3,78.

–  –  –

Интересные результаты получены у подопытной группы коров по продолжительности полового цикла при многократном осеменений. Так, в 16 случаях коровы имели нормальную продолжительность полового цикла, т.е. 18­22 дня (таблица 1).

У коров с большим количеством перегулов (38 случаев) продолжительность периода между двумя осеменениями составила 23­42 дня и это косвенно подтверждает роль гетерозиготного носительства в этиологии ранней эмбриональной смертности у коров.

Известно, что ранняя эмбриональная смертность часто сопровождается удлинением продолжительности полового цикла. В норме предимплантационный эмбрион на стадии морулы и бластоцисты попадает в матку на 5­6­й день после оплодотворения и на 14­17­й день происходит имплантация эмбрионов. Видимо, в данном случае после гибели предимплантационных эмбрионов, некоторое время продолжает функционировать желтое тело, вырабатывается желтым телом гормон прогестерон. Потом, прекращается функция желтого тела, так как погибает эмбрион в результате наследственного фактора, вредной точечной мутации. С точки зрения эмбриональной смертности наиболее критическим периодом по данным литературы является период времени с 8 по 16 дни после оплодотворения. Нами, также с целью выявления коров, носителей генетических дефектов были протестированы 27 коров породы герефорд и среди исследуемых животных носителей мутации генов CD 18 и UMP не выявлены.

В настоящее время существующие методы диагностики не позволяет с большой точностью определить эмбриональную смертность у коров. Однако полученные нами результаты исследования позволяет предположить о роли наследственного фактора в этиологии эмбриональной смертности. Коров контрольной группы в количестве 47 голов осеменяли спермой другого быка­производителя, который не является носителем мутации.

Индекс осеменения в контрольной группе был 1,88 и 38,3 процента животных оказались стельными.

Полученные результаты свидетельствуют, что использование для репродукции животных сперму гетерозиготного носителя мутации BLAD отрицательно влияет на воспроизводительную функцию коров, увеличивается количество коров с безрезультатными осеменениями и повышается индекс осеменения. Для выявления быков­производителей, носителей скрытых генетических дефектов рекомендуем использовать метод полимеразной цепной реакции в сочетании с ПДРФ.


1. Жигачев А.И., Эрнст Л.К., Богачев А.С. О накоплении груза мутаций в породах крупного рогатого скота при интенсивных технологиях воспроизводства и улучшения по целевым признакам// Сельскохозяйственная биология, 2008, № 6, C. 25­32.

2. Марзанов Н.С., Ескин Г.В., Турбина И.С., Девришев Д.А., Тохов М.Х., Марзанова С.Н.

Генодиагностика и распространение аллеля иммунодефицита, или BLAD синдрома, у черно­пестрой породы крупного рогатого скота. –Москва, 2013.­С. 12­15

3. Dunne LD., Diskin MG., Sreenan JM. Embryo and foetal loss in beef heifers between day 14 gestation and full term. Anim Reprod Sci 2000; 58: 39­44

4. Patel R K. Autosomal resseive genetic disorders of cattle breeds Wourdwide – a Review. Journal of Livestock Biodiverity, 2010, Vol.2 n 1. pp 35­41 Шакибаев Е.Б., Усенбеков Е.С., Касымбекова Ш.Н. Казахский национальный аграрный университет, г Алматы, Республика Казахстан



Для решения проблемы обеспечения населения страны продуктами питания важное значение отводится молочному скотоводству, необходимым условием интенсивного ведения которого является максимальное использование генетического потенциала маточного поголовья. Установлена тесная взаимосвязь между технологическими свойствами молока и ДНК полиморфизмом белков молока, полиморфизмом генов лизоцима, лактоферрина и с заболеваемостью маститами, содержанием соматических клеток в молоке [4].

Ген лактоферрина локализован на хромосоме 22 q24, состоит из 17 экзонов и полная последовательность гена 34,5 тыс п.н. Установлена частота генетических вариантов АА, ВВ и АВ лактоферрина у коров голштинской породы, 32,5%, 10% и 57,5% соответственно.

Авторы рекомендуют использовать генетические варианты лактоферрина в качестве ДНК маркера для прогнозирования содержания соматических клеток в молоке и заболеваемости маститом, аллель А гена LTF связана с заболеваемостью маститом у коров [2].

Соматические клетки в молоке (Somatic Cell Counts, SCC) ­ это повышенное содержание в молоке эпителиальных клеток (до 25 %) и лейкоцитов (до 75 %) в результате воспалительного процесса в молочной железе. Установлено, что содержание соматических клеток в молоке у коров колеблется в зависимости от клинического состояния молочной железы, в зависимости от периода лактации, минимальное содержание в молоке соматических клеток в период лактации с 3 по 6 месяцы [1,3].

Изучение полиморфизма гена лактоферрина имеет теоретическое и прикладное значение, так как существует положительная корреляция содержанием в молоке соматических клеток и с генетическими вариантами лактоферрина.

Исследования проводили на 115 коровах голштинской породы племенного хозяйства ТОО «Байсерке­Агро» Талгарского района Алматинской области. Кровь для анализа брали из яремной вены в ваккумную пробирку с антикогулянтом ­ ЭДТА. Работу проводили в учебно­научно­диагностической лаборатории Казахстанско­Японского инновационного центра КазНАУ. ДНК из крови выделяли с помощью набора «ДНК сорб В».

Полимеразную цепную реакцию проводили на термоциклере «Терцик» производства России. Для детекции полиморфизма гена LTF использовали праймеры: F ­ 5*­ GCCTCATGACAACTCCCACAC­3* и R 5*­CAGGTTGACACATCGGTTGAC­3*. Для генотипирования по локусу лактоферрина используется эндонуклеаза EcoRI, которая имеет сайт рестрикции GAATT/C и продукт амплификации длиной 301 п.н. после рестрикции амплификата рестриктазой EcoRI образуются два фрагмента длиной 201 п.н. и 100 п.н.

Условия проведения ПЦР: денатурация при 94 °С – 45 сек, отжиг праймеров – 62 °С 45 сек и элонгация при температуре 72 °С 45 сек и количество циклов 35­40. Объем реакционной смеси: 50 мкл, имеющий следующий состав: 5 мкл 10 Х ПЦР буфера, 1,5 мМ MgCl2, 2,5 мкл 25 мкМ прямого и обратного праймеров, 5 мкл 0,2 мМ концентрации каждого dNTP, 0,5 мкл фермента Taq Polymerase с активностью 5u/l, 5 мкл ДНК и 26,5 мкл дистиллированной воды.

Определение количества соматических клеток в молоке проводили с помощью автоматического прибора Fossomatic 5000. Данный метод является более информативным и на основании результатов исследования можно судить о качестве молока, данный показатель косвенно показывает состояние репродуктивной функции коров. Так, если количество соматических клеток в молоке не превышает 100 тыс клеток в 1 мл молока у индивидуальной коровы, то это очень хороший поакзатель и такие животные имеют хорошую оплодотворяемость.

Таблица 1. Распределение генетических вариантов лактоферрина и частота аллелей гена LTF у коров ТОО «Байсерке­Агро».

–  –  –

Как видно из таблицы 1, всего протестировано 115 голов, из 80% коров оказались гетерозиготными, удельный вес гомозиготного генотипа АА был 3,5 % и ВВ 16,5%.

Диагностику субклинического мастита у исследуемых коров проводили методом подсчета соматических клеток в молока. Содержание соматических клеток в молоке у 19 коров оказалось более 500 тыс 1 мл, минимальное количество соматических клеток в 1 мл молоке было 5 тыс, максимальное количество 1 599 тыс. Известно, что содержание соматических клеток в молоке колеблется в зависимости от возраста животного, сезона года, периода лактации, продуктивности.

Поэтому, нами проведено дополнительное исследование коров на субклинический мастит с помощью димастиновой пробы. У четырех коров, в молоке которых содержание соматических клеток более 500 тыс при димастиновой пробе диагноз субклинический мастит не подтвердился. По результатам подсчета соматических клеток и димастиновой пробы 13 голов оказались гетерозиготными АВ, 2 коровы гомозиготными ВВ. Таким образом, предварительные результаты наших исследовании полморфизма гена лактоферрина у коров показывают, что существует корреляционная связь между генетическими вариантами лактоферрина (АВ) и заболеваемостью субклиническим маститом у коров.


1. Malinowski, E., H. Lassa, A. Kossowska, H. Markiewicz, M. Kaczmarowski and S. Smulski. (2006).

Relationship between mastitis agents and somatic cell count in foremilk samples. Bull. Vet. Inst. Pulawy. 50:349­352.

2. Sharifzaden А., Doosti A. Study of Lactoferrin Gene Polymorphism in Iranian Holstein Cattle Using PCR­ RFLP Technique (2011). Global Veterinaria. 6 (6): 530­536.

3. Schwerin M., Toldo S.S., Eggen A., Brunner R.M., Seyfert H.M., Fries R. (1994): The bovine lactoferrin gene (LTF) maps to chromosome 22 and syntenic group U12. Mammalin Genome, 5, 486–489.

4. Sharma N., Singh N. K., Bhadwal M. S. (2011). Relationship of Somatic Cell Count and Mastitis: An Overview. Asian­Aust. J. Anim. Sci. Vol. 24, No. 3 : 429 – 438 Шепелева Т.А. ФГБОУ ВПО «Уральская государственная академия ветеринарной медицины» г.Троицк, Россйская Федерация



В регионе Южного Урала выявлено 14 разновидностей биогеохимических провинций, сформировавшихся в период развития Земли и в результате загрязнения окружающей среды различными крупными и средними промышленными предприятиями.

По данным космических съемок, в Челябинской области техногенное загрязнение тяжелыми металлами составляет суммарную площадь 29,5 тыс. кв. км. Если прибавить площадь, загрязненную радионуклеидами, то суммарная площадь будет равна 50 тыс. кв. км, или 56% от всей территории области. Ежегодно выбросы загрязняющих веществ составляют 750­800 т свинца, 222 т хрома, 186 т никеля, 880 т ванадия, 95т меди и т. д.

Существующая глубокая, многосторонняя и многоплановая связь между химизмом почв­пород; породпочв ­ растительности; воды­почвы; воды – растительности; почвы – человека; почвы – животных и т.д. приводит к развитию эндемических заболеваний.


При сложившейся ситуации у большинства животных наблюдаются признаки скрытого токсикоза, задержка линьки, поражения кожи (экземы, дерматиты, аллопеции), массовые поражения копытец, болезненность и увеличение печени, болезненность костной ткани (остеомаляция, остеопороз, остеодистрофия), задержания последа, удлинение сервис­ периода.

Сохранение продуктивного здоровья животных зависит от способности адаптироваться и сохранять свой гомеостаз в неадекватных условиях внешней среды. Нарушение экологического равновесия между средой и организмом приводит к нарушению морфофункциональных и энергетических факторов и появлению целого ряда неизвестных ранее групп болезней.

Одним из наиболее часто встречающихся заболеваний в данном регионе является диспепсия новорожденных животных, развивающаяся в первые часы и дни жизни животного и не поддающаяся излечению ранее предложенными способами.

Работу проводили на базе ООО «Деметра» Увельского района Челябинской области.

Хозяйство расположено в одной из зон биогеохимических провинций Южного Урала.

Целью нашей работы явилось изучение влияние аномального содержания макро­ и микроэлементов в кормах и воде на физиологическое состояние коров­матерей и новорожденных телят. На основании полученных результатов разработать схему лечения и профилактики диспепсии у телят.

Микроэлементный состав кормов хозяйства, используемых в рационах коров­матерей, показал повышенный уровень никеля до 5,6мг/кг, кадмия ­ 1,5 мг/кг, свинца ­ 4,8 мг/кг, хрома – 2,6 мг/кг, железа ­ 400 мг/кг и мышьяка ­ 0,9 мг/кг (превышает ПДК в 2­5 раз), на фоне недостаточного содержания меди, цинка, кобальта, йода и достаточного марганца.

Таким образом, прослеживается антагонизм между кобальтом и никелем, марганцем и железом, цинком и свинцом, цинком, медью и кадмием.

При клиническом исследовании коров­матерей на первый план выступают отклонения со стороны костной ткани (болезненность, размягчения хвостовых позвонков и рассасывание 13 ребер на 1/2, 1/3). Болезненность печени. У новорожденных телят низкая живая масса при рождении, болезненность костяка и печени. Заболевают новорожденные телята преимущественно после первой выпойки молозива, иногда расстройства функции желудочно­кишечного тракта начинаются и до кормления, значительно реже отмечали постепенное нарастание симптомов заболевания.

Проведенные биохимические исследования крови, мочи и молозива подтвердили тяжесть патологических процессов, протекающих в организме животных. Так, в крови коров­матерей содержание общего белка превышает нормативные данные на 16%, фосфора ­ 36,8%, снижен уровень глюкозы на 43%, кальция ­ 32%, магния ­ 41%,, хлоридов – 29%.

Количество эритроцитов на нижней границе физиологической нормы, лейкоцитов – на верхней, снижен процент сегментоядерных нейтрофилов, на фоне повышения лимфоцитов.

Нарушено соотношение белковых фракций, на фоне повышения процента альбуминов и альфа­глобулинов резко возрастает количество бета­глобулинов. С мочой в повышенном количестве выводится кальций и магний. Выведение почками свинца, никеля, железа и хрома превышает нормативные данные в 3 – 4 раза, марганца ­ в пределах нормы, а фосфора, цинка, меди ­ ниже нормы.

Молозиво коров­матерей не отвечает предъявляемым требованиям: имеет низкую титруемую кислотность, мало белка, бедно минеральными веществами: кальцием, магнием, фосфором, медью, кобальтом, марганцем и йодом.

При биохимическом исследовании крови новорожденных телят констатировали аналогичные изменения.

Учитывая вышеизложенное, на базе хозяйства организованы и проведены серии научно­производственных опытов, в задачу которых входило:

1) нормализация обменных процессов в организме коров­матерей и улучшение качества молозива;

2) нормализация обменных процессов в организме новорожденных телят и процессов пищеварения.

Стельным коровам за 2 месяца до отела дополнительно в кормовой рацион вводили серу элементарную, монокальция фосфат, магния сульфат, соли кобальта, марганца, цинка, йода и меди.

Предложенный состав позволил нормализовать показатели белкового, углеводного и минерального обмена, улучшить качество молозива и получить более качественное потомство.

Новорожденным телятам, начиная с первой выпойкой молозива, задавали соли микроэлементов: кобальта, марганца, цинка, йода, молибдена и меди. Указанная выше добавка задавалась двум группам животных: телятам, полученным от коров, которые получали соли макро­ и микроэлементов, и телятам, находящимся на обычном кормовом рационе. В результате проведенного анализа биохимического исследования крови и мочи животных установлено, что наиболее благоприятное влияние оказало комплексное применение добавок коровам­матерям и новорожденным телятам. У животных данной группы ранее отмеченные симптомы отсутствовали. Расстройство функции желудочно­ кишечного тракта не отмечалось. Во 2­й опытной группе улучшение общего состояния наступало на 3­4­й день, а полное выздоровление – на 8­10­й день.

Таким образом, состав и применение макро­ и микроэлементов в данном случае адресные с учетом данной биогеохимической провинции. Корректировка обменных процессов в организме животных должна продолжаться на протяжении всей жизни животного.


1.Кабыш А.А.Нарушение фосфорно­кальциевого обмена у животных на почве недостатка и избытка микроэлементов в зоне Южного Урала. ­ Челябинск, 2006.­ 408с.

2.Колб В.Г., Камышников В.С. Клиническая биохимия. – Минск, 1976. –С. 195­200.

3.Лукашик Н.А., Тащилин В.А. Зоотехнический анализ кормов. – М.: Колос, 1967. – 216с.

4.Никепелов Б.В. и др. Радиационная авария на Урале // Атомная энергия. Т67. вып 2, 1989.­ с 75 Юмагузин И.Ф., Садыкова Р. Р. ФГБНУ Башкирский научно-исследовательский институт сельского хозяйства, г. Уфа, Россйская Федерация


Введение. Увеличение продолжительности продуктивного использования коров является одним из резервов повышения продуктивности стада и рентабельности отрасли.

Долголетнее использование коров также связано с темпами ремонта стада и интенсивностью отбора. Однако с внедрением промышленных технологий на молочных комплексах и фермах и увеличением уровня молочной продуктивности снижается средний возраст животных в стаде за счет преждевременного выбытия коров. Сроки использования коров молочных пород в России в настоящее время не превышают 2,88…3,50 отела, т.е. коровы не доживают до 4…6 лактации, когда проявляется наивысшая продуктивность и окупаются затраты на выращивание телок, нетелей и содержание продуктивных животных. Это происходит из­за нарушений обмена веществ, снижения воспроизводительной способности, непригодности к машинному доению и заболеваний, связанных с невозможностью животных адаптироваться к интенсивной технологии [1; 3;


Другой не менее важной причиной снижения продуктивного долголетия коров является замена пород местной селекции на специализированную черно­пеструю, а также массовый завоз высокопродуктивных животных голландской и голштинской пород из­за рубежа, которые более требовательны к условиям содержания и не приспособлены к резко континентальному климату природно­экологической зоны Южного Урала.

Несоответствие высокого генетического потенциала молочной продуктивности и условий, необходимых для его реализации в сельхозпредприятиях региона, приводит к преждевременному выбытию животных из стада [2; 5].

Материал и методика. В задачи наших исследований входило изучить зависимость продуктивного долголетия коров от генетических факторов или линейной принадлежности.

Нами проанализировано продуктивное долголетие и молочная продуктивность 318 черно­ пестрых коров в ООО «Игенче» Дюртюлинского района Республики Башкортостан.

Результаты исследований. В ходе исследований установлено, что наибольшим продуктивным долголетием ­ 4,2 лактации ­ отличались коровы черно­пестрых линий (Таблица 1), превосходивших голштинских животных на 1,1 лактацию (p0,01).

–  –  –

Самый длительный период продуктивного использования был у коров линии Примуса

– 4,4 лактации, наименьшим сроком эксплуатации характеризовались животные линии Уес Идеала – 2,9 лактации (p0,01).


При оценке эффективности использования коров из разных генеалогических групп установлено, что больший пожизненный удой имели коровы тех линий, которые отличались й длительностью продуктивного долголетия ( (Рисунок 1).

17000 5,0 4,5

–  –  –

Рисунок 1 ­ Пожизненный удой и продуктивное долголетие коров разных линий Сравнительная оценка пожизненной продуктивности коров показала, что более высокий удой за всю жизнь (16768 кг) был получен от животных черно черно­пестрой линии Примуса. Их превосходство над коровами линии Танталуса составило 226 кг, или 1,4%, Атлета ­ 260 кг, или 1,6%, Аннас Адема – 413 кг, или 2,5%, Посейдона – 443 кг, или 2,7%, Рефлекшн Соверинга ­ 1098 кг, или 7,0%, Монтвик Чифтейна – 1243 кг, или 8,0% и Уес Идеала – 1441 кг, или 9,4%. Однако разница по данному показателю между животными сравниваемых групп оказалась статистически недостоверной.

17000 9,00 8,00 16500 7,00

–  –  –

6,00 5,00 4,00 3,00 2,00

–  –  –

2,5 1,5 0,5

–  –  –

Рисунок 2 ­ Эффективность разведения коров разных линий Необходимо отметить, что удой в среднем на 1 день жизни и на 1 день лактации животного, который характеризует эффективность его использования, был выше у голштинских линий (Рисунок 2).

У голштинских животных удой на 1 день жизни и на 1 день лактации составил 8,39 и 15,81 кг, что больше, соответственно, на 20,2 и 23,3%, чем у коров черно­пестрых линий (p0,001).

Максимальный удой на 1 день жизни и 1 день лактации был у коров линии Уес Идеала, соответственно, 8,57 и 16,78 кг, минимальный – линии Примуса, 6,82 и 12,10 кг (p0,001).

Заключение. Таким образом, для повышения генетического потенциала стада и экономической эффективности отрасли необходимо шире использовать голштинских быков­ производителей, оцененных по качеству потомству как улучшатели.


1. Дмитриева В.И., Кольцов Д.Н., Гонтов М.Е., Чернушенко В.К. Продуктивное долголетие коров и влияние на него ряда факторов // Зоотехния. ­ 2009. ­ №7. ­ С. 16­18.

2. Крючкова, H.H., Стародумов И.М. Продолжительность хозяйственного использования коров черно­ пестрой породы разного уровня молочной продуктивности // Зоотехния. ­ 2008. ­ №2. ­ С. 16.

3. Лебедько Е.Я. Повышение числа лактации у коров // Достижения науки и техники АПК. ­ 2001. ­ № 8. ­ С. 15­16.

4. Суровцев В.Н., Галсанова В.С. Влияние срока продуктивного использования коров на конкурентоспособность молочного животноводства // Зоотехния. ­ 2008. ­ №5. ­ С. 21­22.

5. Шарафутдинов Г.С., Шайдуллин Р., Ханифатуллин А., Хасанов И. Влияние различных факторов на продуктивное долголетие коров // Молочное и мясное скотоводство. ­ 2005. ­ №4. ­ С. 33­34.



Быстрова И.С., Горбунова Н.В.ФГБОУ ВПО Саратовский государственный аграрный университет имени Н.И. Вавилова, г. Саратов, Россйская Федерация



Анализ тенденций развития мясной промышленности свидетельствует о повышении интереса к производству мясных изделий в виде сырых полуфабрикатов, максимально подготовленных к употреблению. Научные разработки направлены на получение высоких выходов, сокращение потерь при кулинарной обработке, сохранение органолептических характеристик, улучшение функциональных свойств сырья и готовых изделий, повышение пищевой ценности, увеличение сроков годности изделий.

Данная статья посвящена разработке функциональных пищевых продуктов на основе мяса индейки. Мясо индейки обладает рядом преимуществ перед другими видами сельскохозяйственных птиц.

К ним относятся [1]:

1. Высокие показатели по живой массе и выход после обвалки, которые могут быть выше 70 % (для сравнения из кур можно получить не более 50% мясного сырья).

2. Высокая пищевая и биологическая ценность белков мяса индейки обусловлена значительным содержанием и оптимальным соотношением незаменимых аминокислот, а коэффициент усвоения белков организмом человека превышает 90%.

3. Мясо индейки очень нежное, не вызывает аллергии, поэтому рекомендуется детям.

По сравнению с другими видами птиц содержит незначительное количество холестерина ­ 74 мг на 100 г.

4. Оно богато железом, селеном, магнием и калием, содержит витамины: PP, B6, B12, B2.

–  –  –

Таким образом, можно сделать вывод о том, что мясо индейки является отличным источником мясного сырья при производстве мясных полуфабрикатов функционального назначения, ввиду своих высоких пищевых свойств.

–  –  –

Использование специфических свойств ликопина позволит улучшить пищевые свойства продукта как с технологической, так и с биологической точки зрения.

Целесообразность применения ликопина в рецептурах мясных продуктов профилактического направления обусловлена следующим [3]:

1.Высокие антиоксидантные свойства ликопина. В ряде проведенных исследований было показано, что регулярное употребление в пищу продуктов, содержащих в своем составе этот каротиноид, снижает вероятность сердечно­сосудистых заболеваний и рака.

2. Положительное влияние ликопина на пищеварительную систему включает следующие проявления: нормализацию аппетита; активацию пищеварительных желез;

прекращение размножения болезнетворных бактерий в кишечнике. Ликопин принимает участие в поддержании кислотно­щелочного равновесия в крови, активирует обмен веществ, благодаря чему снижается избыточный вес.

3. На кровеносной системе его действие проявляется в укреплении сосудистых стенок и капилляров, благодаря чему снижается вероятность кровотечений.

4. Ликопин обладает противогрибковыми и антибактериальными свойствами, что может положительно повлиять на срок хранения мясных полуфабрикатов.

5. Так как ликопин – это, прежде всего пигмент, содержащийся в растениях, обуславливающий их окраску, необходимо изучить его красящие свойства и их сохранность при тепловой обработке.

Использование различных круп при производстве полуфабрикатов позволит не только снизить себестоимость готового продукта, но и повысить стабильность технологических свойств мясных полуфабрикатов. Также, не стоит упускать из виду обогащение продукта пищевыми волокнами, которые способствуют пищеварению и очищению организма в целом[2].

Разрабатываются несколько рецептур новых полуфабрикатов для функционального питания. Это продукты с пониженным содержанием соли, безнитритные для различных групп населения. Также разработана рецептура более доступных для потребителя мясных полуфабрикатов из мяса индейки с растительным компонентом, а именно овсяной крупой.

Данные мясные продукты являются натуральным продуктом, направленным на улучшение питания населения нашей страны и снижения дефицита различных биологических веществ, получаемых из продуктов питания.

–  –  –

Из вышеизложенного материала мы можем сделать вывод о том, что разработки в данных сферах необходимы и выгодны не только для потребителя, но и для мясных производств. Создание функциональных продуктов из мяса индейки позволит расширить ассортимент, удовлетворить спрос потребителей на продукты с функциональными свойствами, повысить производственные свойства мясных полуфабрикатов, а также создать безнитритные продукты.


1. Алексеев, Ф.Ф. Индейка перспективная мясная птица / Ф.Ф. Алексеев // Птица и птицепродукты. ­ 2005, №5. ­ С. 12­15.

2. Бочкарева, З.А. Разработка технологий функциональных пищевых продуктов из рубленого мяса с продуктами переработки зерна: дис. … канд. техн. наук / З.А. Бочкарева. – М., 2006 – 204 с.

3. Ликопин ­ антиоксидант для борьбы против морщин и рака. Включаем ликопин в рацион питания – Режим доступа: http://meduniver.com/Medical/profilaktika/likopin_ot_morchin_i_raka.html Иванов Д.А., Мишина О.Ю. ФГБОУ ВПО «Волгоградский государственный аграрный университет» г. Волгоград, Россйская Федерация



В последние годы появились сыры, которые можно объединить в новый класс – «Сыры диетические (функциональные)». К функциональным относят продукты, которые при систематическом употреблении стимулируют жизнедеятельность организма в целом или оказывают определенное регулирующее действие на определенные системы, органы или функции организма. [1] В настоящее время, несмотря на большой ассортимент плавленых сыров на рынке, происходит его постоянное обновление за счет появления новых вкусовых решений, вариантов упаковки продукта, изменения сырьевого состава и т.д. Под влиянием экономических условий предприятиям сыродельной отрасли приходится изыскивать дополнительные резервы для снижения себестоимости выпускаемой продукции при сохранении потребительских качеств и конкурентоспособности. [3] Одним из способов расширения производства может служить производство так называемых «альтернативных», «аналоговых», или «имитационных сыров», произведенных по технологии плавленых сыров, но близких по вкусу и консистенции к полутвердым сырам голландской группы или сырам с чеддеризацией.

Данные продукты занимают промежуточное положение между сычужными и плавлеными сырами и могут производиться без включения в состав сыра или с минимальным его содержанием. [3] Согласно официальным данным, в 2014 г. перед введением эмбарго (с января по июль) доля сырных продуктов в общем объеме потребления сыров и сырных продуктов составляла 19%, тогда как годом ранее – 11,3 %. Удельный вес сырных продуктов растет как в производстве, так и в импорте. Прирост производства сырных продуктов за 8 месяцев 2014г.

составил 35,5% по сравнению с аналогичным периодом 2013 г. [4] Замена в сырах молочного жира на растительный связана с двумя направлениями разработок, а именно:

­ совершенствование потребительских свойств плавленого сыра, предназначенного для промышленного использования, например, в условиях мясоперерабатывающих предприятий при производстве изделий с добавлением сыра, а также в качестве начинок при производстве кондитерской и хлебобулочной продукции;

­ создание нового продукта, для непосредственного употребления в пищу, который по своим органолептическим свойствам напоминает натуральный сыр.

Существует два основных метода производства сыров, в которых молочный жир и белок частично или полностью заменены на растительный. При частичной замене используется технологические методы традиционного сыроделия, а при производстве сыра без молочных составляющих или с их небольшим содержанием, созревание не предусматривается. Процесс изготовления конечного продукта состоит из нескольких операций. Упрощенно это можно представить как простое смешивание нагретого масла с предварительно подготовленным порошком и усилителями аромата. После охлаждения смеси продукт готов к упаковке. [4] Полная или частичная замена молочного жира на растительные аналоги обеспечивает снижение себестоимости продукции, стабилизирует ее качество, так как производство и состав заменителей не подвержены сезонным колебаниям, в отличие от свойств и характеристик молочного жира.

Физико­химические показатели растительных жиров, например «SolPro»

применяющихся в молочной промышленности, максимально приближены к свойствам молочного жира (таблица 1).

–  –  –

В отличие от молочного жира, заменитель молочного жира (ЗМЖ) «SolPro» содержит меньшее количество транс­изомеров жирных кислот и холестерина, оказывающих негативное влияние на организм человека. ЗМЖ имеет однородную пластичную консистенцию, чистый вкус, свойственный обезличенному жиру. [2] Исследования сырных продуктов с новым сырьевым составом являются достаточно актуальными в условиях современного рынка и позволяют расширить ассортимент выпускаемой продукции без ущерба для качественных характеристик.

Улучшение рациона питания, развитие современных технологий, дефицит качественного молочного сырья и его высокая стоимость, рост конкуренции со стороны импортной продукции вызывают большой интерес отечественных производителей к изготовлению продуктов с использованием растительных компонентов.


1. Гудков А.В. Сыроделие: технологические, биологические и физико­химические аспекты [Текст]:

монография. ­ М.: ДеЛи принт, 2004. ­ 804 с.

2. ЗМЖ «SolPro» для производства молокосодержащей продукции [Текст] / Колпакова М.Е. // Сыроделие и маслоделие.­2014.­№5. ­ С. 48­49.

3. Новые виды продукции ­ основной ресурс стабильной работы [Текс] / Дунаев В.А., Коноплева А.А. // Сыроделие и маслоделие. ­ 2014. ­ №5. ­ С. 22­23.

4. Сырный продукт ­ дальний родственник сыра [Текст] / Рыбалова Т.И // Сыроделие и маслоделие. ­ 2014. ­ № 6. ­ С.6­8.

Муханов Н.В., Крупин А.В., Барабанов Д.В. ФГБОУ ВПО «Ивановская государственная сельскохозяйственная академия имени академика Д.К.Беляева», г. Иваново, Россйская Федерация


Первой компанией, начавшей промышленное производство доильных роботов, была голландская Lely. Разработка прототипа доильного робота началась в 1985 году:

исследователи изучали возможность автоматического обнаружения положения вымени и присоединения доильных стаканов. И только через 7 лет, в 1992 году у Lely вышел на рынок доильный робот Astronaut. Сейчас их производят по лицензии Lely фирмы Fullwood и Bou­ Matic. А компании АМС Liberty, DeLaval, SAC и другие выпускают системы автоматического доения по собственным технологиям. [1,2] В России собственное производство доильных роботов до сих пор не налажено, но импортные роботы используются. Первым хозяйством в России, установившем в 2006 году системы добровольного доения VMS компании DeLaval, стал «Племзавод Родина»

(Вологодская область) [2]. С тех пор уже сотни хозяйств приобрели и эксплуатируют доильных роботов. Но всё же их внедрение происходит не столь интенсивно, как в Западной Европе, США и Канаде. Дело в том, что в странах Западной Европы и Северной Америки самым дорогостоящим является человеческий труд и его замена роботом актуальна и быстро окупаема. К услугам западных фермеров гибкая система кредитования с низкими процентными ставками, гарантированный сбыт продукции по выгодной цене. Для российских аграриев именно инвестиционная составляющая является проблемной, да и реализация даже высококачественного молока не всегда отличается высокой прибыльностью, а вот стоимость труда в России существенно ниже. Помимо этого, существуют и другие сложности, о которых стоит подумать, прежде чем приобретать робота.

Проведя анализ рекламных проспектов, видеороликов и других материалов производителей доильных роботов, а также выслушав мнения специалистов и руководителей хозяйств, где уже используются роботы, мы постарались обобщить все «за» и «против».

–  –  –

Ну и главный минус доильных роботов – их высокая стоимость, которая колеблется в зависимости от производителя и комплектации от 100 до 170 тыс. евро. То есть при покупке доильного робота с низкой ценой следует учитывать, что фирма­производитель или ее дилеры не включают в указанную стоимость цену за дополнительное оборудование (например, за вакуум­силовую установку, парогенератор, компрессор и прочее), программное обеспечение и другие опции, которую затем придется платить дополнительно, как за комплементарные товары.

Кроме этого, при принятии решения о приобретении доильного робота или строительстве доильного зала следует учитывать такие факторы как климатические условия, в которых находится хозяйство, технологию содержания животных, численность поголовья и продуктивность животных, кормовую базу, кадровый потенциал и, конечно же, наличие финансов.

Подводя итог, можно отметить, что доильные роботы можно рекомендовать для небольших ферм от 50 до 400 голов дойного стада, где содержатся животные с высоким генетическим потенциалом, имеются высококвалифицированные кадры и крепкая кормовая база. А для крупных молочных ферм и комплексов, на наш взгляд, рациональнее использование доильных залов.


1. Холманов А, Осадчая О., Алексеенко А. Доильные роботы: преимущества и проблемы // Животноводство России / Молочное скотоводство. – №9. – 05.2008. – С.73­75.

2. Доильные роботы на российском рынке // АгроРынок. – №19. – 10.2012 – С. 47­48.

Рудик Ф.Я., Быстрова И.С., Горбунова Н.В.ФГБОУ ВПО Саратовский государственный аграрный университет имени Н.И. Вавилова, г. Саратов, Россйская Федерация



Птицеводство – отрасль сельского хозяйства, которая производит крайне необходимые для здоровья человека продукты питания. Анализ динамики производства продукции птицепрома за последние годы показал значительное увеличение доли мяса птицы в общем объеме производства всех видов мяса в России. Однако с ростом производства значительно возрастают объемы вторичного сырья при переработке птицы, составляющие порядка 30% от живой массы.

В связи с этим предприятия птицеперерабатывающей промышленности характеризуются значительным количеством мало или вовсе невостребованного вторичного сырья: головы, ноги, шкурка, перо и кость.

Ежегодно в мясной отрасли России образуется около 1 млн т вторичных ресурсов, из которых промышленно перерабатывается не более 20 %. Исходя из этого, в перспективе в Российской Федерации необходимо широкое внедрение схем комплексной переработки вторичного сырья. Это позволит более рационально их использовать, а также увеличивать объем и ассортимент производимой продукции, что в целом повысит эффективность и экологическую безопасность предприятий по переработке птицы [1].

С одной стороны, в настоящее время во многих регионах России существует проблема переработки отходов мясной и молочной промышленности. Такое ценное сырьё, как куриная кость, в основном выбрасывается или, в незначительном количестве, используется для приготовления мясо – костной муки. С другой стороны, мировые тенденции в области питания связаны с созданием ассортимента продуктов, способствующих улучшению здоровья при ежедневном потреблении в составе рациона функциональных продуктов.

Функциональные продукты определяются тремя основными качествами: пищевая ценность, вкусовые качества и физиологическое воздействие [2].

С целью повышения функционально­технологических свойств и снижения себестоимости продукции целесообразно использовать вторичные продукты убоя птицы, а именно куриную кость. Экономическая целесообразность и высокое содержание кальция в курином порошке позволяют положительно оценить перспективы использования этих малоценных вторичных продуктов мясной отрасли.

Куриная кость обладает высокими ресурсными, не востребованными в настоящее время показателями. Разработка технологии производства пищевой добавки из куриной кости позволит повысить рентабельность производства, за счет использования вторичных ресурсов птицепрома.

Вместе с тем промышленная переработка кости позволит рационально использовать отходы птицепереработки, доля которых только на территории Саратовской области составляет 4 тыс. т., улучшая при этом экологическую обстановку в области.

Порошок из куриной кости позволит решить одну из важных проблем дефицита незаменимых веществ питания населения. Кальций является основным структурным элементом куриной кости, находится он в биодоступной форме, что позволяет использовать порошок из куриной кости для производства продуктов функционального назначения и пищевых добавок.

Pages:     | 1 | 2 || 4 | 5 |   ...   | 16 |
Похожие работы:

«ИННОВАЦИОННЫЕ ТЕНДЕНЦИИ РАЗВИТИЯ РОССИЙСКОЙ НАУКИ Министерство сельского хозяйства Российской Федерации Департамент научно-технологической политики и образования Федеральное государственное образовательное учреждение высшего профессионального образования «Красноярский государственный аграрный университет» Красноярское региональное отделение Общероссийской общественной организации «Российский союз молодых ученых» Совет молодых ученых КрасГАУ ИННОВАЦИОННЫЕ ТЕНДЕНЦИИ РАЗВИТИЯ РОССИЙСКОЙ НАУКИ VII...»

«ФАНО РОССИИ Федеральное государственное бюджетное научное учреждение «Донской зональный научно-исследовательский институт сельского хозяйства» НАУЧНОЕ ОБЕСПЕЧЕНИЕ АГРОПРОМЫШЛЕННОГО КОМПЛЕКСА НА СОВРЕМЕННОМ ЭТАПЕ сборник материалов международной научно-практической конференции п. Рассвет, УДК 631.527: 631.4:633/635: 632. ББК 40.3:40.4:41.3:41.4:42:44.9 Н3 Редакционная коллегия: Зинченко В.Е., к.с.-х.н., директор ФГБНУ «ДЗНИИСХ» (ответственный за выпуск); Коваленко Н.А., д.б.н., зам. директора по...»

«Министерство сельского хозяйства РФ ФГБОУ ВПО «Государственный аграрный университет Северного Зауралья» «ПЕРСПЕКТИВЫ РАЗВИТИЯ АПК В РАБОТАХ МОЛОДЫХ УЧЁНЫХ» Сборник материалов региональной научно-практической конференции молодых учёных 5 февраля 2014 г. Часть Тюмень 201 УДК 333 (061) ББК 40 П 27 П 27 Перспективы развития АПК в работах молодых учёных. Сборник материалов региональной научно-практической конференции молодых учёных / ГАУ Северного Зауралья. Тюмень: ГАУСЗ, 2014. – 251 с....»

«ИННОВАЦИОННЫЙ ЦЕНТР РАЗВИТИЯ ОБРАЗОВАНИЯ И НАУКИ INNOVATIVE DEVELOPMENT CENTER OF EDUCATION AND SCIENCE АКТУАЛЬНЫЕ ПРОБЛЕМЫ СЕЛЬСКОХОЗЯЙСТВЕННЫХ НАУК В РОССИИ И ЗА РУБЕЖОМ Выпуск II Сборник научных трудов по итогам международной научно-практической конференции (10 февраля 2015г.) г. Новосибирск 2015 г. УДК 63(06) ББК 4я43 Актуальные проблемы сельскохозяйственных наук в России и за рубежом / Сборник научных трудов по итогам международной научно-практической конференции. № 2. Новосибирск, 2015....»


«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ НИЖЕГОРОДСКАЯ ГОСУДАРСТВЕННАЯ СЕЛЬСКОХОЗЯЙСТВЕННАЯ АКАДЕМИЯ ФАКУЛЬТЕТ ЛЕСНОГО ХОЗЯЙСТВА Лесное хозяйство 2014. Актуальные проблемы и пути их решения Материалы международной научно-практической Интернет – конференции Нижний Новгород – 2015 ОРГАНИЗАТОРЫ КОНФЕРЕНЦИИ: Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования Нижегородская государственная сельскохозяйственная академия Департамент...»

«Министерство сельского хозяйства Российской Федерации Министерство образования Республики Башкортостан Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «Башкирский государственный аграрный университет» Совет молодых ученых университета СТУДЕНТ И АГРАРНАЯ НАУКА Материалы VI Всероссийской студенческой конференции (28-29 марта 2012 г.) Уфа Башкирский ГАУ УДК 63 ББК 4 С 75 Ответственный за выпуск: председатель совета молодых ученых, канд. экон....»


«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РФ ФГБОУ ВПО «Государственный аграрный университет Северного Зауралья» Департамент АПК Тюменской области Совет молодых учёных и специалистов Тюменской области Тобольская комплексная научная станция Уральского отделения РАН Северо-Казахстанский государственный университет им. М. Козыбаева УО «Белорусская государственная сельскохозяйственная академия» Вестфальский университет имени Вильгельма, Германия СОВРЕМЕННАЯ НАУКААГРОПРОМЫШЛЕННОМУ ПРОИЗВОДСТВУ Сборник...»



«Министерство сельского хозяйства Российской Федерации Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «Пермская государственная сельскохозяйственная академия имени академика Д.Н. Прянишникова»МОЛОДЕЖНАЯ НАУКА 2014: ТЕХНОЛОГИИ, ИННОВАЦИИ Материалы Всероссийской научно-практической конференции, молодых ученых, аспирантов и студентов (Пермь, 11-14 марта 2014 года) Часть Пермь ИПЦ «Прокростъ» УДК 374. ББК М 7 Научная редколлегия: Ю.Н. Зубарев,...»

«Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «Воронежский государственный аграрный университет имени императора Петра I» Государственное научное учреждение «Научно-исследовательский институт экономики и организации АПК ЦЧР России Россельхозакадемии» Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «Белгородская государственная сельскохозяйственная академия имени В.Я. Горина»...»

«Министерство сельского хозяйства Российской Федерации ФГБОУ ВПО «Ульяновская ГСХА им. П.А.Столыпина» Материалы IV Всероссийской студенческой научной конференции (с международным участием) В мире научных открытий 20-21 мая 2015 г. Том VI Часть 1 Ульяновск 2015 Материалы IV Всероссийской студенческой научной конференции (с международным участем) «В мире научных открытий» / Ульяновск: ГСХА им. П.А.Столыпина, 2015. Т. VI. Ч.1. 270 с.Редакционная коллегия: В.А.Исайчев, первый проректор проректор по...»

«Министерство сельского хозяйства Российской Федерации Федеральное государственное учреждение высшего профессионального образования «Уральская государственная академия ветеринарной медицины» Материалы международных научно-практических студенческих конференций «ИННОВАЦИИ СТУДЕНТОВ В ОБЛАСТИ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ», 28-31 МАРТА 2011 ГОДА «ОПЫТ ТОВАРОВЕДЕНИЯ, ЭКСПЕРТИЗЫ ТОВАРОВ И ПРОФЕССИОНАЛЬНОЙ ПОДГОТОВКИ В СОВРЕМЕННОМ ОБЩЕСТВЕ», 25-28 АПРЕЛЯ 2011 ГОДА Троицк-2011 УДК: 619 ББК:30.609 М-34...»

«Министерство сельского хозяйства Российской Федерации ФГБОУ ВПО «Ульяновская государственная сельскохозяйственная академия им. П.А. Столыпина» Материалы III Всероссийской студенческой научной конференции (с международным участием) В МИРЕ НАУЧНЫХ ОТКРЫТИЙ 20-21 мая 2014 г. Том IV Ульяновск 2014 Материалы III Всероссийской студенческой научной конференции (с международным участием) «В мире научных открытий» / Ульяновск:, ГСХА им. П.А. Столыпина, 2014, т. IV. 225 с. Редакционная коллегия: В.А....»

«ФГБОУ ВПО «Госуниверситет – УНПК» Департамент сельского хозяйства Орловской области Некоммерческое Партнерство «Орловская гильдия пекарей и кондитеров» Ассоциация сельхозтоваропроизводителей, предприятий пищеперерабатывающих производств и торговли – «Орловское качество».ЗДОРОВЬЕ ЧЕЛОВЕКА И ЭКОЛОГИЧЕСКИ ЧИСТЫЕ ПРОДУКТЫ ПИТАНИЯ-20 МАТЕРИАЛЫ Всероссийской научно-практической конференции 31 октября 2014 г., г. Орел Орел 2014 УДК 664 + 60] (062) ББК 36.80-9я 431+36.80-я 4 З-46 Здоровье человека и...»

«Министерство сельского хозяйства Российской Федерации1 Министерство сельского, лесного хозяйства и природных ресурсов Ульяновской области ФГБОУ ВПО «Ульяновская государственная сельскохозяйственная академия имени П.А. Столыпина» МАТЕРИАЛЫ Международной научно-практической конференции «Фундаментальные и прикладные проблемы повышения продуктивности животных и конкурентоспособности продукции животноводства в современных экономических условиях АПК РФ» Том СЕКЦИИ: I «РАЗВЕДЕНИЕ, СЕЛЕКЦИЯ И ГЕНЕТИКА...»



2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.