- , ,

Pages:   || 2 | 3 | 4 | 5 |   ...   | 15 |

- , 70- ...

-- [ 1 ] --

. ..


, 70-

100- .. (25-26 2015 ) III 2015 001:63 40 347


- , 70- 100- .. (25-26 2015 .). 3- . III. : . .. , 2015. 332 .

- , ; . , . , .

, .


.., ;

.., ;

.., ;

.., . ;

.., . ;

.., . ;

.., . , ;

.., . ;

.., . ;

.., . , ;

.., . , .

ISBN 978-5-91777-156-4 , 2015.

, 2015.


, (1939 ), ! 100 .

, , , ;

, !

- , - , , ; - , . , , , . , , , . , , , , , . , . , , , . , ! , , - , .

, , !


.., ..


., .. XI

.., ..

.. 16

.., .., .., ..



.., ..

ȅ 25

.., .. ȅ..27 .., .. ۅ 30 .., ..

ۅ 35

.., ..

. 41

.., .. Յ. 46 .., .. Ļ


ȅ.. 50 .., .. ۅ.. 52 .., .. () ۅ 56 .., .., .., ..

.. 61 .., .. . 64 ., ..

.., ..


Ӆ. 71 .., .. .76 .., .. . 80 .., .. -9 . .. 83 ., .. -

.., .. -9 . 91 .., .. FCI ʅ 97 .., ..

ۅ.. 99

.., .. - Ʌ 103 .., .. ۅ... 107

., .. л . -, ߅. 116 .., .., .., ..

. 119 .., ..


ܻ Ż 123 .., .. Ʌ... 126 .., .. ȅ. 133 .., .. ۅ. 138 .., .. ҅. 143 .., .., .. , , ȅ. 145 .., .. . 150 .., .. ҅. 154 .., ..

̅ 158 .., .. 162 .., .. 166 ., .. ӻ

ͻ . -, ߅. 172 -

.., .. ߅ 175 .., .., .., .. 179 .., ..

… 184 .., .., .. .. 187 .., .. ͅ. 191 .., .. …. 195 M.E., ..

… 200 .., .., .., ..

ȅ.. 204 .., .. Ʌ 210 .., .., .. .. 213 .., .. ʅ 218 .., .., .. ߅ 223 .., ..

߅ 227 .., .. ͅ.. 231

.., .., ..

ȅ. 237

.., .. ȅ 244 .., .. 255 .., .., ..

߅ 260 .., .. ȅ.. 265 .., ..

. .. 273

.., .., .. 420-140

ʅ. 277

.., .. Ʌ 283 .., .. Ņ. 287

.., .. Ņ 291 .., ..


߅ 294 .., ..

. ( ) 300 .., .. (Ochotona hyperborea Pall., 1881) (Ochotona daurica Pall., 1776) 303 .., .., .., ..

߻ 306 .., ..

.. 310 .., .. ΅.315 .., ..


.., ..


Ż ( ).. 325 .., .., .. (Ochotona hyperborea Pall., 1881)

. ( ,

).. 327



.. . .. , . , ( ) , . , . , -. , 4.45% , .

: , , .



Scientific supervisor - Karpova E.A.

Irkutsk State Agrarian University named after A.A. Ezhevsky, Irkutsk, Russia In connection with periodic outbreaks of tick-borne encephalitis (hereinafter -KE) and the possibility of transmission through the alimentary by eating raw goat's milk and cow's milk is urgent investigation for the presence of TBE virus. A group of students conducted a study on the presence of TBE virus in raw milk obtained from cows educational farm "IsAA." For detection of virus, using polymerase chain reaction diagnostics. It was established that the virus is present in 4.45% of samples of milk from cows farm.

Keywords: milk, tick-borne encephalitis virus, polymerase chain reaction.

Ixodes persulcatus Ixodes ricinus.

( ), , [5].

I. persulcatus 300 .

, , -, (, , ) [3]. . , [6,7].

- . . 1-3 4-7 . , . , , . . 5-7 12 . - . [8].

, , [2], , , , - . - . , , , [3].

, , .

. 23 (26.09.2014) . -18 . .

- ().

100 300 . - / ( , ) .

-L ( , ).

: , -

(. ). 2720 (Applied Biosystems, ).

, (67 mM Tris-HCl (pH 8.9), 16.6 mM (NH4)2SO4, 2 mM MgCl2, 0.01% Tween-20, 200 M 4- dNTP, 5% ), 0.5 M ( ), 2U q -. , (4 ). (1 ).

20 .

, 5- C-prM-ENS1 ( 2402-2424 2517-2539 ..) , 3- ( 2199-2219 2214-2238 ..), NS1, (). - , (, ). : 94 2 30 , 36 (94 30 , 48 30 , 72 30 ), 72 3 . : 94 2 30 , 36 (94 30 , 50 30 , 72 30 ), 72 3 .

/ 16S . Ehr1 Ehr2, Ehr3 Ehr4 (. 1).

1 - ,


2 30 94, 36 (94 30 , 48 30 , 72 1 30 ). I 3- . 72.

2 30 94, 36 (94 30 , 50 30 , 72 30 ). II 3- 72.

. 23 , , 1 (. 2).

, , , , , . ( ). , , , .

2 - , ( 26.09.2014)


. 4.54% . , , - . , , .

1. .. / . .. , .. , .. . : - 2001. 932 .

2. .. . . / .. // . 2007. 4 (126).

. 14-21.

3. .. : /. . .: , 2008. 656 .

4. .., .. , / .. , .. . : . -, 2005. 116 .

5. .. Ixodes persulcatus Schulze (Acarina. Ixodidae).

, , , . / . . .. . .:

, 1985. 420 .

6. .. / ..

// . , 1965. . 47-50.

7. .. / .. , .. , .. // . II . . . -, 1970. . 34-36.

8. .. - : , / .. , .. , .. // (), 2012. .. 111,N 4.-.91-93 3 .


, , .


- XI . XI , . , 76 ..

3% . (N= 86) XI .

: XI , , , .


disease - deficiency of coagulation factor XI. Phenotypically deficiency of coagulation factor XI in cows accompanied endometritis, mastitis and high index of insemination. The authors recommend to detect the insertion of nucleotide sequences of 76 bp use the polymerase chain reaction and a horizontal 3% agarose electrophoresis.According to the study (N = 86) homozygous and heterozygous carriers of a genetic defect - deficiency of coagulation factor XI were not identified.

Keywords: deficiency of coagulation factor XI, autosomal recessive disease, insertion, reproductive function of cows.


XI . 1969 . , . , , XI (FXID) 12 FXI 76 . STOPcodon (TAA) [1].

. , , . . , XI (FXID) , . , XI , , , [2].

, FXI , . , XI , [3].

- , . , , , [4].

XI .

35 - 24 37 - -- - .

. ». : 200 , 1 , 100 , 20 , 10 NaCI, 8.0 30 , g 10000 / 5 . , 500 : 100 , 20 , 10 NaCI, 8.0 8 2-. 1 30 .

. XI : 5F- CCCACTGGCTAGGAATCATT - 3 R- 5- CAAGGCAATGTCATATCCAC FXID 244 .. , 244 .. 320 .. 320 .. ( 1).

: - 95 10 , 35 , 95 30 , 55 60 72 30 . 72 10 . +4 . 50 , : 5 10 , 1.5 MgCl2, 2.5 25 , 5 0.2 dNTP, 0,5 TaqPolymerase 5u/l, 5 26.5 .

1 - FXI

. - ». FXID 35 . , 244 .., , ( 76 ..) 320 ..

59 - 37 -. 244 ., (1-13) - pUC19DNA (.1), MspI.

, 501,489, 404, 331, 242, 190, 147, 111, 110, 67, 34, 34 , 244 .. 242 .. . , XI (FXID).

. , , XI .

1. Marron B.M., Robinson J.L., Gentry P.A., Beever J.E.Identification of a mutation associated with factor XI deficiency inHolsteincattle.Anim Genet. 2004 Dec;35(6):454-6.

2. Kunieda M., Tsuji T., Abbasi A.R., Khalaj M., Ikeda M., Miyadera K., Ogawa H.,Kunieda T. (2005) An insertion mutation of the bovine F11 gene is responsible for factor XI deficiency in Japanese black cattle. MammGenom 16:383-389.

3. Meydan H, YildizM.A, zdil F, Gedik Y., zbeyazC. Identification of factor XI deficiency inHolsteincattle in Turkey. Acta Vet Scand. 2009, Jan 22;51:5.

4. Patel R K.,SoniK.J., ChauhanJ.B.,. SinghK.M.,Krothapalli R.S. Sambasiva Rao Factor XI deficiency in Indian Bostaurus, Bosindicus, Bostaurus x Bosindicus crossbreds and Bubalusbubalis. Genet. Mol. Biol. So Paulo 2007.,vol.30 no.3.

1 .

, , .



. 1 29%, , . 3185 . ., 0.8% , . 0.9%, 1.2%, - 1.26%. 459 850.0 , 1.1% , , .

: , , , .




The paper presents the results of growing steers on low-cost technologies.The keeping of animals in the premises of the lightweight type on permanent litter has lowered the total cost of 1 kg of growth of 29%, mainly due to lower costs of mechanization, electricity and number of employees. Gobies are contained devil leash consumed 3185 food. unit, which is 0.8% more than the content on a leash. Also they had consumed more protein 0.9%, metabolizable energy of 1.2%, dry matter of the ration - by 1.26%. At the same time the most absolute and average daily gain in live weight average for the period of cultivation was higher in animals with tie content and amounted to 459 kg and 850.0 g, respectively, which is 1.1% more than in steers contained without a leash.

Keywords: fattening cattle, "cold" method, low-cost technology, facilities lightweight type.

, , , . , .

, . , . , .

, [1,2,3,5].


( ) .



- ;

- , ;

- .

. 2012 2013 . . , . . , , (1 ) (2 ) .

. , 9001000 . . , 6- : 1 , 2 100 (. 1).

1 ( - , - ) . .

. 1.


. , , [4]. 2 3185 . ., 0.8% , 1 . 0.9% - 3 . 2 1.2% , 1.26% , , .

, .


2 - ( 1 )


1 . 1 494 , 5 1% , 2 .

18 1 459 850.0 , 1.1% , 2 .

, .


3 -


, 17%, 38.8%. . 1 3 4 .

82.5 (39%), , , . , , . .

1 90 , 450 . , 50%. , 12 000 , 18 000 .

, 41% 50%, 1

3569. 36 , 28.6%.

, , 1 , . .

1. .. /.., .. // . 2008. - 3. .60-63.

2. ..

/.., .. // .- 2011. - 5(84). .120-121.

3. .. /.., .., .. // . 2008. .6. - 6.


4. .. /.., .., .. // . 2011. - 11-12. .55-60.

5. ..

/.. // . 2012. 1. .160-164.

5 .

, .





- 88 9 (GDF9). Primer3.

LTF- 62 GDF-9 58 . LTF .

- .

: , , , GDF-9, .


The work on the genotyping of breeding cows LLP "Bayserke-Agro" in the amount of 88 goals for the loci lactoferrin gene and differentiation growth factor 9 (GDF9). For the identification of genetic variants at loci studied constructed by the authors of forward and reverse primers using Primer 3. Experimentally established the optimum temperature for annealing of primers amplifying a region of the gene LTF - 62 C and GDF-9 gene is 58 C. The correlation between genetic variants and disease gene LTF subclinical mastitis.Recommended for genotyping of animals used PCR-RFLP analysis on the studied loci.

Keywords: subclinical mastitis, DNA markers, PCR, GDF-9 gene, restriction amplificate.

(LTF) , . , , . (LTF) - , - [1].

LTF 22q24, 17 34.5 .. , , 32.5%, 10% 57.5% .

, LTF [2].

Pages:   || 2 | 3 | 4 | 5 |   ...   | 15 |


.. - , 15- ۻ 70- , , .. 16-18 2015 . 2015 339.13 ...

1 , .. - Ի : I , ...

һ : VII - 22 2014 . I ...

.. - , 70- 100- .....

. .. III ( ) 20-21 2014 . II 1 2014 III ( ) / :, . .. , 2014, . II. 1. 217 . ...

߻ - X - 16-17 2015 , 2015 338.43 4 34 ...

һ IV (31 1 2010 .) 63 4 75 : , . ....

I -...

һ : IV - (16-17 2011 .) 63 4 75 : ,...

- (25-27 2014 .) - , 80- II , 201 63:00 65. 568 : ...

.. VI - 2015 338.436.33:620.9 31:65. 4 42 : VI / . . .. ...

- I » , 85- II 338.436.33:005.745(06) 65.32 431 263 263...

- XXI : , , ...

ISSN 2077-5873 - III - ʻ: - . III. (--, 2728 2014 ) ...

. .. . .. IV - , , , 70- (1941-1945 .) 100- .. (28-31 2015 ) ...

- 80 631 40 : .. -, .. , .. , .. , .. , .. , .. : .. . 80. :...

- (2 2015 .) 3 9. 10. , ...

. .. III ( ) 20-21 2014 . IV 2014 III ( ) / :, . .. , 2014, . IV. 225 . : .....

- - . , 631.527: 631.4:633/635: 632. 40.3:40.4:41.3:41.4:42:44.9 3 : .., ..-.., ջ ( ); .., ..., . ...

˲ò Ҳ ѲҲ IJ ˲Ͳ ۻ - ʻ V 631.145:378 40+74.58 .. : ., ʳ .., .., ...

<<     |    
2016 www.konf.x-pdf.ru - - , ,

, .
, , , , 1-2 .