WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 


Pages:   || 2 | 3 | 4 |

«Микробиологические и экологические особенности штаммов иерсиний, циркулирующих на территории Якутии ...»

-- [ Страница 1 ] --

ФЕДЕРАЛЬНОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕ НАУКИ «САНКТПЕТЕРБУРГСКИЙ НАУЧНО-ИССЛЕДОВАТЕЛЬСКИЙ ИНСТИТУТ

ЭПИДЕМИОЛОГИИ И МИКРОБИОЛОГИИ ИМ. ПАСТЕРА»

На правах рукописи

СОФРОНОВА Октябрина Николаевна

Микробиологические и экологические особенности штаммов иерсиний,

циркулирующих на территории Якутии

03.02.03. – микробиология

Диссертация на соискание ученой степени кандидата

медицинских наук

Научный руководитель:

Заслуженный деятель науки РФ, доктор медицинских наук, профессор Г.Я. Ценева Санкт-Петербург - 2014

ОГЛАВЛЕНИЕ

ВВЕДЕНИЕ…………...……………………………………...……………………........4 Глава 1.ОБЗОР ЛИТЕРАТУРЫ….………………………….………………………..29

1.1. Распространение иерсиниозов в мире и в России……………..…........29

1.2. Источники и факторы передачи инфекции……………………..….….35

1.3. Особенности полиморфизма клиники иерсиниозов…………….….....39

1.4. Характеристика биологических свойств иерсиний……………….......40

1.5. Молекулярно-генетическая характериcтика бактерий рода Yersinia..46

СОБСТВЕННЫЕ ИССЛЕДОВАНИЯ

Глава 2. ХАРАКТЕРИСТИКА ЗАБОЛЕВАЕМОСТИ ИЕРСИНИОЗАМИ НА

ТЕРРИТОРИИ ЯКУТИИ..……………………………………….…………………...5

Глава 3. ОСОБЕННОСТИ РАСПРОСТРАНЕНИЯ ИЕРСИНИЙ НА ТЕРРИТОРИИ

ЯКУТИИ……………………………………………………………………….....…....57

3.1. Распространение иерсиний в объектах окружающей среды……….…..57 3.1.1.Распространение иерсиний в популяциях грызунов…………………..59 3.1.2. Распространение иерсиний в объектах окружающей среды (смывах с овощей, воде открытых водоемов, почве, смывах с оборудования общественного питания)………………………………………………………………….…………....61

3.2. Микробиологический мониторинг объектов окружающей среды в осваеваемых промышленных районах Якутии………………………………64

Глава 4. ХАРАКТЕРИСТИКА БИОЛОГИЧЕСКИХ СВОЙСТВ ИЕРСИНИЙ,

ЦИРКУЛИРУЮЩИХ В ЯКУТИИ…….……………..…………………………..…73

4.1. Принадлежность штаммов Yersinia различного происхождения к био- и серотипам ……………………………………………………………………...73

4.2. Применение молекулярно-генетических методов для определения патогенных свойств иерсиний………………………………………………...74 4.2.1. Применение ПЦР при исследованиях проб из объектов окружающей среды и материала от больных……………………………………………..…75 4.2.2. Молекулярно-генетическая характеристика штаммов по наличию некоторых генетических детерминант вирулентности …………………..…80 4.2.3. Изучение генетических характеристик штаммов, обусловленных генами gyrB и ompF…………………………………………………………....78

Глава 5. СЕРОЛОГИЧЕСКИЙ СКРИНИНГ АНТИТЕЛ К ВОЗБУДИТЕЛЯМ

ПСЕВДОТУБЕРКУЛЕЗА И КИШЕЧНОГО ИЕРСИНИОЗА В

СЕЛЬСКОХОЗЯЙСТВЕННЫХ И ПРОМЫШЛЕННЫХ УЛУСАХ (РАЙОНАХ)

ЯКУТИИ……….……

5.1. Серологическая диагностика иерсиниозов у больных ………………...85

5.2. Серологический скриниг иерсиниозов у здорового населения………..87

5.3. Серологический скриниг иерсиниозов у сельскохозяйственных животных……………………………………………………………………….89

Глава РАЗРАБОТКА СИСТЕМЫ МИКРОБИОЛОГИЧЕСКОГО

6.

МОНИТОРИНГА ЗА ЦИРКУЛЯЦИЕЙ ИЕРСИНИЙ В УСЛОВИЯХ

ЯКУТИИ……………………..………..…………………………………….………...91 ЗАКЛЮЧЕНИЕ……………………………………………………………………...99 ВЫВОДЫ..……….…………………………………………………………………..107 ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ………………......……………...…............108 ПЕРСПЕКТИВЫ ДАЛЬНЕЙШЕЙ РАЗРАБОТКИ ТЕМЫ……….……………....109 СПИСОК СОКРАЩЕНИЙ………………………………………………………….110 СПИСОК ЛИТЕРАТУРЫ...…………………………….……………………….…..11

ВВЕДЕНИЕ

Актуальность темы исследования Ежегодно в мире инфекционные и паразитарные болезни регистрируются более чем у 2 млрд. людей. В результате глобализации экономической деятельности, открытия границ, миграции населения, роста объемов международных сообщений и торговли возрастает тенденция распространения инфекционных болезней в будущем. Одним из важных факторов, способствующих росту заболеваемости, является изменение вирулентности и токсинообразующей способности патогенных микроорганизмов [33].

В четвертом оценочном Докладе Межправительственной группы экспертов по изменению климата (МГЭИК –IPCC) в 2008 г. особое внимание уделяется опасности увеличения инфекционной заболеваемости на Севере, в связи с изменением климата и, как следствие, смещение границ леса к северу, равно как и смещение ареала возбудителей и переносчиков инфекционных болезней. В арктических городах происходит рост как среднегодовых и среднемесячных температур, так и числа дней с аномально высокой температурой. В г. Якутске в период с 1999 по 2007 гг. по сравнению с 1961 -1990 гг. средняя температура января увеличилась на 5° С, июля на - 1,4° С, число экстремально жарких дней возросло в 1,7 раза; в результате климатических изменений происходит сокращение территории вечной мерзлоты, и место тундры может занять тайга. С эпидемиологической точки зрения это означает возможность расширения ареалов обитания ряда видов грызунов, являющихся источниками возбудителей многих инфекций [24, 41]. В этой связи реально появление новых подвидов микроорганизмов с измененными биологическими, в том числе, генетическими свойствами [52].

Yersinia pseudotuberculosis и Yersinia enterocolitica широко распространены во многих странах мира, являясь причиной спорадической и групповой заболеваемости. При этом псевдотуберкулез характерен, в основном, для территорий с умеренным и холодным климатом, а кишечный иерсиниоз распространен повсеместно. Следует подчеркнуть, что фактическая заболеваемость этими инфекциями выше, однако, на ряде территорий регистрация иерсиниозов не проводится, диагностика иерсиниозов осуществляется не на должном уровне и не по единой схеме [7, 52].

Существующие малоактивные природные очаги трансформируются в структурно сложные антропургические очаги, с эпизоотическим процессом в популяциях синантропных грызунов, действующих на территории населенных пунктов [59].

На территории Якутии в период 1979-1998 гг. зарегистрировано 13 вспышек псевдотуберкулеза и кишечного иерсиниоза [15].

Значительным итогом научных исследований последних десятилетий являются доказательства этиологической роли ряда представителей вида Y.

enterocolitica в качестве возбудителя кишечного иерсиниоза.

Проблема острых кишечных инфекций (ОКИ) для Якутии актуальна. В период 2002-2011 гг. в структуре всех ОКИ, как среди взрослого, так и детского населения, доминировали острые кишечные инфекции неустановленной этиологии (ОКИНЭ), которые составили 77,8±1,6 и 66,5±2,3%, соответственно [2].

Выявлены региональные особенности возбудителей ОКИ: из 20 широко распространенных бактерий, вызывающих кишечные заболевания, в Якутске наиболее часто встречаются 11 видов энтеробактерий, в том числе Y.

enterocolitica.

По данным ряда исследователей природные очаги бактериальных инфекций на Севере отличаются значительным своеобразием: циркумполярным распространением, адаптацией возбудителей к типичным для Севера представителям фауны, способностью к размножению в переносчиках и во внешней среде при низких температурах, в изменчивом климате (влажность, оттаивание «вечномерзлых» грунтов (вечная мерзлота). Проблема инфекционной заболеваемости продолжает оставаться актуальной для региона. Многие микробиологические и экологические аспекты, связанные с иерсиниями в условиях Севера, остаются неизученными, и официальная статистика не отражает их истинного распространения [15, 47]. Отсутствуют данные о циркуляции этих бактерий в условиях повышения среднегодовых температур в Якутии, их роли в возникновении заболеваний ОКИНЭ. Практически нет данных о распространении иерсиний среди диких, синантропных и сельскохозяйственных животных. Ограничены данные об обсемененности объектов окружающей среды на территории Якутии. Не исследованы экологические особенности сохранения иерсиний в условиях низких температур и в условиях повышения среднегодовых температур. В этой связи организация и проведение микробиологических мониторинговых исследований на территории Якутии представляется актуальной.

Степень разработанности темы исследования В Якутии первая вспышка псевдотуберкулеза была зарегистрирована в сентябре 1974 г. в Мирнинском районе. В дальнейшем до 1998 г. было зарегистрировано еще 13 вспышек псевдотуберкулеза и кишечного иерсиниоза [6].

В 90-х годах в Якутии при групповых заболеваниях кишечным иерсиниозом от людей выделяли Y. kristensenii. По данным литературы, этот вид иерсиний способен продуцировать энтеротоксин YKST, вызывающий симптомы пищевого отравления. Данные по распространению редких видов иерсиний в различных географических зонах ограничены, требовалось уточнение значимости этиологической роли Y. kristensenii, Y. intermedia, Y. frederiksenii [90].

Использование многопраймерной ПЦР - перспективное направлением детекции видов бактерий рода Yersinia. Обнаружение генетического материала непатогенных - Y. kristensenii, Y. frederiksenii, Y. intermedia, Y. bercovieri, Y.

mollaretii, Y. rohdei в биологических образцах больного человека может свидетельствовать о том, что клинические проявления инфекционного заболевания могут быть вызваны видами иерсиний, считавшимися ранее непатогенными [43].

Важной эпидемиологической особенностью возбудителей является изменение пейзажа циркулирующих иерсиний, уменьшение доли ранее доминировавших серотипов, а также появление новых серо-биотипов Y.

enterocolitica, ранее считавшихся непатогенными [79].

Считалось, что патогенные организмы не могут размножаться во внешней среде, а лишь сохраняются в ней. Вопреки установившемуся мнению, что температурный оптимум для размножения патогенных микробов находится в пределах 37 °С, и они являются мезофилами, полученные данные на модели (Y.

pseudotuberculosis, Y. еnterocolitica) позволили подтвердить концепцию в экологии этих микробов. Культивирование Y. pseudotuberculosis при +8 °С в условиях низкой аэрации увеличивает их адгезивную и инвазивную активность [41]. Эти свойства могут быть следствием адаптации микроорганизма к разным условиям обитания в различных географических зонах, в том числе, в условиях Крайнего Севера.

Между тем, сведения о распространении ведущих серо-биотипов и их биологических характеристиках по отдельным географическим зонам России представлены не полностью.

Y. enterocolitica 1А не имеет классических факторов вирулентности:

плазмиды (pYV), гена адгезии (ail) и гена энтеротоксина (ystА). Однако, у непатогенных представителей биотипа 1А обнаружен ген ystВ, кодирующий термостабильный энтеротоксин YST В, который может играть роль в патогенезе диарей [79]. До настоящего времени циркулирующие на Севере Y. enterocolitica биотипа 1А по признаку патогенности не изучались, равно как и больные с диарейным синдромом на иерсиниозы не обследовались.

–  –  –

Цель исследования: микробиологическая характеристика штаммов иерсиний, циркулирующих на территории Якутии, и разработка тактики микробиологического мониторинга иерсиниозов.

Задачи исследования:

Установить распространенность представителей рода Yersinia на 1.

территории Якутии в различных объектах окружающей среды, в том числе, в популяциях мелких млекопитающих.

Охарактеризовать штаммы по наличию генетических детерминант 2.

вирулентности. Оценить генетическое родство штаммов иерсиний различных видов, изолированных в антропургических и природных очагах Якутии.

Оценить заболеваемость иерсиниозами и этиологическую значимость 3.

иерсиний, циркулирующих на территории Якутии, при ретроспективном иммунологическом обследовании людей и сельскохозяйственных животных.

Разработать тактику микробиологического мониторинга за 4.

циркуляцией иерсиний для территорий Якутии.

Научная новизна исследования На основе комплексного микробиолого-эпидемиологического изучения возбудителей иерсиниозов у людей, животных и в объектах окружающей среды установлена циркуляция различных видов бактерий рода Yersinia (Y.

pseudotuberculosis, Y. enterocolitica, Y. kristensenii, Y.intermedia, Y.frederiksenii) на территориях народно-хозяйственного освоения Якутии.

Получены новые знания о выделении и частоте распространения иерсиний «редких» видов (Y. kristensenii; Y.intermedia) от грызунов и из воды открытых водоемов. Выделенные на территории Якутии Y._enterocolitica биотипа 1А от грызунов, из овощей и других объектов окружающей среды, ранее, отнесенные к непатогенным иерсиниям, обладают патогенным потенциалом.

Выявлено, что в 80% случаев штаммы Y._enterocolitica биотипа 1А, считающиеся непатогенными, содержат ген ystB, опосредующий продукцию термостабильного энтеротоксина, что позволяет судить о наличии патогенного потенциала у бактерий, и может обуславливать диарейные проявления у больных с острыми кишечными инфекциями неустановленной этиологии.

На основе выявленных положительных результатов серологических исследований проб больных, страдающих ОКИ, гастроэнтероколитами, здоровых людей, а также животных, получена информация о распространенности иерсиниозов на территории Якутии, которые свидетельствуют о широкой циркуляции иерсиний на изученной территории.

Теоретическая и практическая значимость исследования Установлена широкая распространенность бактерий рода Yersinia различных видов (Y. enterocolitica, Y. kristensenii, Y. рseudotuberculosis; Y.

intermedia; Y. frederiksenii; Yersinia spp.) на территории Якутии в условиях «вечной мерзлоты». Доказано, что наиболее часто встречается Y. enterocolitica и Y. kristensenii, основным резервуаром которых в природных и антропургических очагах являются разные виды мелких млекопитающих (серые крысы, полевки, лемминги), что является особенностью территории.

Для исследованных штаммов Y. kristensenii и Y. intermedia раскрыты филогенетические связи и установлены генетические различия, обусловленные полиморфизмом гена gyrB, что вносит существенный вклад в характеристику популяции иерсиний данных видов.

На основе полученных данных, комплексного изучения иерсиний на территории Якутии, был разработан алгоритм микробиологического мониторинга за иерсиниями, включающий порядок организации и проведения лабораторной диагностики с учетом климатических условий, который будет способствовать осуществлению эффективного эпидемиологического надзора за иерсиниозной инфекцией.

Изученные штаммы и их характеристики представлены в коллекции Референс центра по мониторингу за иерсиниозами при ФБУН НИИ эпидемиологии и микробиологии имени Пастера.

Для повышения эффективности диагностики псевдотуберкулеза и кишечного иерсиниоза в организациях здравоохранения Якутии внедрены методы ИФА (акт внедрения от 26.12.2011 г. и 26.11.2013 г.) и ПЦР (акт внедрения от 25.12.2012 г.).

В ФГБУ «НЦЭСМП» МЗ России депонирован штамм Y. kristensenii № 1511, выделенный со смыва из местного картофеля и содержащий хромосомный ген термостабильного энтеротоксина ykst, который может быть использован в качестве тест-штамма при проведении мониторинга за Y. kristensenii.

Полученные данные были использованы при создании документов:

1. Профилактика иерсиниоза: санитарно-эпидемиологические правила СП 3.1.7.2615-10 / Ю.В. Демина, С.В. Сенников, Г.Я. Ценева, Е.А Воскресенская, Е.

А. Богумильчик, О.Н. Софронова, М.В. Чеснокова, В.Т. Климов, К.А Тирских, О.А. Бургасова, Л.К. Иванова, Т.В. Каримова, Л.В. Саяпина - М.: Изд-во ФГУЗ «ФЦГЭ Роспотребнадзора». - 2010. - 19 с.

2. Микробиологический мониторинг циркуляции иерсиний в Республике Саха (Якутия): республиканские методические рекомендации. (МР) /И.Ю. Самойлова, В.И. Григорьева, О.Н. Софронова, В.Ф. Чернявский, О.Н. Никифоров,

И.А.Романова, П.С. Дьячковская, Е.А. Воскресенская, Г.Я, Ценева - СПб.:

ВМемА - 2013. – 84 с.

Методология и методы исследования Методология данной работы соответствует поставленной цели.

Предметом исследования явилось выделение с целью изучения распространения штаммов иерсиний, обитающих на территории Якутии, их молекулярно-генетическая характеристика. Анализ научной литературы, посвященной проблеме, проведен на основе формально-логических методов исследования. Планирование и проведение исследований, направленных на решение поставленных задач проводилось на основе общенаучных и специфических методов. Материал, методы исследований, использованные для работы представлены в таблице 1.

–  –  –

дней. Дальнейшие исследования материала проводили в соответствии действующими методическими указаниями МУ 3.1.1.2438-09 «Эпидемиологический надзор и профилактика псевдотуберкулеза и кишечного иерсиниоза».

Сыворотки крови людей и животных Образцы сывороток крови (ОСК) исследовали на наличие антител к Y.

enterocolitica и Y. pseudotuberculosis. При диагностических исследованиях антитела определяли в динамике, первую пробу отбирали в конце 1-й недели, вторую – на 14 день. При серологическом скрининге людей и животных антитела к иерсиниям определяли методами РНГА и ИФА в одном ОСК.

Материал от мелких млекопитающих Образцы органов мелких млекопитающих растирали в асептических условиях в ступке с песком и фосфатно-буферным раствором; 1,5 мл взвеси переносили в 5 мл среды накопления и исследовали в соответствии с методическими указаниями МУ 3.1.1.2438-09 «Эпидемиологический надзор и профилактика псевдотуберкулеза и кишечного иерсиниоза».

Объекты внешней среды Пробы смывов с объектов внешней среды пищеблоков ДДУ, ОУ, ЛПО, предприятий общепита, овощных магазинов, цехов, складов, в очагах иерсиниозной инфекции, отбирали, стерильным тампоном, помещали в 5 мл среды накопления.

Образцы проб из помета, гнезд грызунов, погадки растирали в ступке с песком и фосфатно-буферным раствором; 1,5 мл взвеси переносили в 5 мл среды накопления для исследования.

Воду открытых водоемов в количестве 1-2 л. исследовали методом концентрации на мембранных фильтрах.

Почву 50-100 г помещали в среду накопления в соотношении 1:10 и для посева использовали надосадочную жидкость.

Исследования проводили в соответствии с методическими указаниями МУ 3.1.1.2438-09 «Эпидемиологический надзор и профилактика псевдотуберкулеза и кишечного иерсиниоза».

Образцы овощей, фруктов Измельченные образцы овощей и фруктов помещали в 0,85% физиологический раствор, на следующий день 1 мл раствора помещали в 5 мл среды накопления. Исследования проводили в соответствии методическими указания МУ 3.1.1.2438-09 « Эпидемиологический надзор и профилактика псевдотуберкулеза и кишечного иерсиниоза».

Культуры иерсиний Всего на территории Якутии бактериологическим методом выделено 237 штаммов бактерий рода Yersinia.

Исследовано молекулярно-генетическими методами 171 свежевыделенных штаммов, в том числе Y. pseudotuberculosis - 3, Y. enterocolitica – 99, Y. kristensenii

- 50, Y. intermedia – 2, Y. frederiksenii – 2, и неидентифицированные до вида Yersinia –15 штаммов.

Y. pseudotuberculosis - 3 штамма:

- 3 штамма выделены из органов серых крыс в г. Якутске (птицеферма – Племобъединение) в 2009 г.

Y. enterocolitica – 99 штаммов:

- Y. enterocolitica биотипа 1А – 89, в том числе 37 штаммов, выделенных из органов мелких млекопитающих (Горный, Намский, Мегино-Кангаласский, Ленский, Алданский, Анабарский районы, Якутск); 40 штаммов из овощей (овощные ларьки, склады – Нерюнгринский, Алданский, Мегино-Кангаласский, Амгинский, Намский районы, Якутск); 12 штаммов из объектов окружающей среды и с объектов общепита (смывы с тары, поддона, стеллажей, весов, таза для салатов, мешка, доски для резки овощей, подтоварника, стола для разделки овощей – Вилюйский, Нерюнгринский, Амгинский районы, Якутск);

- Y. enterocolitica – биотипов 2, 4 – 10 штаммов, в том числе 2 штамма, выделенные из овощей, 3 штамма из смывов, 5 штаммов от грызунов (Анабарский, Амгинский, Горный, Нерюнгринский районы, Якутск).

Y. kristensenii – 50 штаммов, в том числе 47 штаммов из органов грызунов, 1 штамм из воды открытых водоемов, 2 из помета куньих (Анабарский, Булунский, Горный районы, Якутск).

Y. intermedia – 2 штамма, выделенные из органов грызунов (Якутск).

Y. frederiksenii – 2 штамма, в том числе 1 выделен из смыва с тары (Якутск), 1 из органов грызунов (Булунский район).

Бактерии рода Yersinia, вид которых установить не удалось –15 штаммов, выделенные из органов грызунов (Горный, Намский, Мегино-Кангаласский, Анабарский районы, Якутск).

Также, кроме выше перечисленных культур иерсиний 3 штамма Y.

pseudotuberculosis были дополнительно использованы при генотипировании гена

gyrB, которые хранились при -80 0С:

- 2 штамма выделены из испражнений больных в 1994г., 2000г. в Алданском районе и в г. Якутске;

- 1 штамм выделен из органа серой крысы в Алданском районе п. Томмот в 2001г.

Также использованы референс – штаммы Y. enterocolitica IP 8081 (из коллекции института Пастера, Париж); охраноспособный штамм Y. enterocolitica КМ 205 и охраноспособный штамм Y. pseudotuberculosis КМ 211 (из Государственной коллекции патогенных бактерий «Микроб», г. Саратов).

–  –  –

Бактериологический метод Выделение иерсиний из материала проводили по схеме (Рисунок 1) посевом в пептонно-калиевую среду с «холодовым» обогащением при температуре +4 - +8 0С и с последующим высевом материала на 3, 7, 10 сутки на плотную питательную среду СБТС (производство ФБУН «ГНЦ ПМБ», п.

Оболенск). При использовании среды Эндо проводили щелочную обработку.

Исследуемый материал

–  –  –

Рисунок 1. Схема выделения и идентификации иерсиний

Высевы проводили на дифференциальные среды, содержащие мочевину:

Олькеницкого, Клиглера, Любарева; универсальный скошенный столбик (УСС).

Идентификацию и дифференциацию уреазоположительных культур проводили при помощи тестов: методом флуоресцирующих антител (МФА) для детекции Y.

pseudotuberculosis. Определение оксидазного теста, образование индола (+28 °С), ферментативной активности на средах Гисса (+28 °С), проводили с использованием набора реактивов питательных сред для идентификации энтеробактерий (производство ФБУН ГНЦ ПМБ, п. Оболенск; ФГУП НПО «Микроген», г. Махачкала; « Медис», г. Ростов – на –Дону). Использовали системы индикаторные бумажные для идентификации энтеробактерий (производство ФГУП НПО «Микроген», г. Нижний Новгород).

Определение подвижности проводили при +22 и +37 °С. Проводили реакции с псевдотуберкулезным фагом при +28 °С (производство ФКУЗ РосНИПЧИ «Микроб», Саратов).

Для определения биохимических свойств исследованных штаммов использовали среды и реагенты согласно общепринятым методикам [28, 29].

Дифференциацию Y. pseudotuberculosis О:1 и Y. enterocolitica пяти биоваров и других видов бактерий рода Yersinia проводили в соответствии с методическими указаниями МУ 3.1.1.2438-09 «Эпидемиологический надзор и профилактика псевдотуберкулеза и кишечного иерсиниоза».

Видовую принадлежность выделенных культур устанавливали на основании комплекса типичных морфологических, тинкториальных, культуральных, биохимических, антигенных свойств.

Штаммы Y. pseudotuberculosis и, так называемых, Y. enterocolitica-like видов (близкородственных Y. enterocolitica видов инерсиний), исследовали также с помощью тестов, включенных в состав «Тест-системы для внутриродовой и внутривидовой дифференциации бактерий рода Yersinia», разработанной в лаборатории бактериальных инфекций ФБУН НИИ эпидемиологии и микробиологии имени Пастера [5].

В таблице 2 приведен набор биохимических тестов, использованных для окончательной идентификации выделенных культур.

Серотипирование культур проводили с Y. pseudotuberculosis использованием диагностических иммуноглобулинов для РА на стекле «Иммуноглобулины диагностические псевдотуберкулезные поливалентные адсорбированные лошадиные для реакции аглютинации на стекле, лиофилизат для диагностических целей», предназначенных для идентификации Y.

pseudotuberculosis I-VI сероваров (производство ФКУЗ РосНИПЧИ «Микроб», г.

Саратов) в соответствии прилагаемой инструкцией, а также с использованием набора коммерческих моновалентных сывороток к серотипам Y.

pseudotuberculosis О:1 и О:3 в реакции агглютинации (РА) на стекле (производство ФБУН НИИ эпидемиологии и микробиологии имени Пастера, г.

Санкт-Петербург).

Таблица 2 Биохимические свойства изолированных штаммов Yersinia

–  –  –

Идентификация вирулентных иерсиний Идентификацию вирулентных иерсиний проводили с использованием промышленных серий диагностической сыворотки к вирулентным иерсиниям (СВИ) (производство ФБУН НИИ эпидемиологии и микробиологии имени Пастера, Санкт-Петербург). Реакция со СВИ основана на выявлении белков наружной мембраны иерсиний, детерминированных плазмидой pYV 46 MDa в реакции агглютинации (РА) на стекле, в соответствии с методическими рекомендациями «Псевдотуберкулез и иерсиниозы» – СПб, 2005.

Идентификация бактериофагом диагностическим псевдотуберкулезным Идентификацию возбудителя псевдотуберкулеза проводили с использованием диагностического псевдотуберкулезного бактериофага (производство ФКУЗ РосНИПЧИ «Микроб», г. Саратов). Ориентировочную пробу с бактериофагом псевдотуберкулезным ставили методом «стерильного пятна» в соответствии с прилагаемой инструкцией.

Молекулярно-генетические методы Для выделения ДНК из образцов фекалий, эмульсий органов грызунов, помета птиц, погадок хищных птиц использовали коммерческий набор "ДНКсорб-В" (производство ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, г.

Москва); для выделения ДНК из смывов, овощей, воды открытых водоемов, почвы использовали коммерческий набор "ДНК-сорб-С" (производство ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, г. Москва), согласно прилагаемой инструкции.

Для выявления и дифференциации специфических участков ДНК вирулентных и авирулентных штаммов Y. enterocolitica и штаммов Y.

pseudotuberculosis использовали коммерческие тест-системы:

«АмплиСенс® «АмплиСенс®

- Yersinia enterocolitica-Eph, Yersinia ФБУН ЦНИИЭ Роспотребнадзора, г.

pseudotuberculosis-Eph (произодство Москва), ПЦР проводили в программируемом термостате ТП4-ПЦР-01-«Терцик»

(производство ЗАО «НПФ ДНК-Технология», Россия) с электрофоретической детекцией продукта амплификации в 1% агарозном геле с окрашиванием бромистым этидием;

- «АмплиСенс® Yersinia enterocolitica/Yersinia pseudotuberculosis-FL», вариант FEP/FRT-50, с набором реагентов ПЦР - смесь -1- FEP/FRT Y.

еnterocolitica/ Y. рseudotuberculosis и ПЦР- смесь -1- FEP/FRT Y. enterocolitica type (производство ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, г. Москва) с гибридизационно - флуоресцентной детекцией. Амплификацию, анализ и учет результатов проводили при помощи прибора Rotor - Gene Q, (производство Qiagen, Германия) в режиме «реального времени» (FRT) или детекцию результатов проводили с помощью флуоресцентного ПЦР - детектора Ala с версией программного обеспечения 5.1.0. Постановку реакций проводили согласно прилагаемым инструкциям.

- Штаммы Y. enterocolitica изучены на наличие генов ail (адгезия-инвазия), ystB и ystA (гены термостабильных энтеротоксинов), yscQ, (pYV 42-48 MDa) методом ПЦР. Штаммы Y. pseudotuberculosis исследованы на наличие ypm А/С (ген cуперантигенного токсина), yscQ (pYV), irp2 (HPI). В качестве контрольных использовали референтные штаммы, обладающие плазмидой вирулентности pYV, генами ail и ystA (референс-штамм Y. enterocolitica IP 8081 из института Пастера, Париж), геном ystB (охраноспособный штамм из Государственной коллекции патогенных бактерий «Микроб» г. Саратов Y. enterocolitica КМ 205) и геном ypm А/С (охраноспособный штамм из Государственной коллекции патогенных бактерий «Микроб» г. Саратов Y. pseudotuberculosis КМ 211). Штаммы Y.

kristensenii, Y. intermedia, Y. frederiksenii и не идентифицированные до вида Yersinia были исследованы на наличие всех вышеперечисленных генов.

Для получения лизатов бактерии выращивали на агаре Хоттингера, готовили взвесь с концентрацией 108 м.к./мл в стерильной дистиллированной воде, 100 мкл взвеси кипятили 5 мин, центрифугировали при 10 тыс. об/мин 1 мин, использовали надосадок. Применяли пары праймеров (производство ООО «Синтол», г. Москва). Для выявления гена ail использовали пары праймеров:

Forward (5’-3’) Reverse (5’-3’)

TAATGTGTACGCTGCGAG,

GACGTCTTACTTGCACTG [92], длина продукта - 351 пн. Для выявления гена использовали пары праймеров: (5’-3’) ystA Forward (5’-3’) ATCGACACCAATAACCGCTGAG, Reverse CCAATCACTACTGACTTCGGCT [92], длина продукта 79 пн. Для выявления гена применяли пары праймеров: (5’-3’) ystB Forward GTACATTAGGCCAAGAGACG, Reverse (5’-3’) GCAACATACCTCACAACACC, длина продукта - 146 пн. Для выявления плазмидного гена yscQ использовали пары праймеров: Forward (5’-3’) TATGCGCATTATCTCGGGAC, Reverse (5’-3’) TTAACCGCCGACTTACTAGG, длина участка гена - 178 пн [24]. Для выявления гена ypm А/С использовали: Forward (5’-3’) CACTTTTCTCTGGAGTAGCG, Reverse (5’-3’) ACAGGACATTTCGTCA длина участка гена составляла 422 пн Для выявления гена использовали: Forward (5’-3’) [69]. irp2 AAGGATTCGCTGTTACCGGAC, Reverse (5’-3’) TCGTCGGGCAGCGTTTCTTCT длина участка гена составляла 280 пн [81]. Определение гена ykst проводили в ФБУН НИИ эпидемиологии и микробиологии имени Пастера.

Реакционную смесь для проведения ПЦР готовили с использованием стандартных реагентов (производство «Fermentas», Литва) согласно прилагаемой инструкции: 2,5 мкл 10х Taq-буфера с (NH4)2SO4, 2 мМ/мкл MgCl2, 0,2 мМ/мкл каждого дНТФ, 0,4 мкМ/мкл прямого и обратного праймеров, 0,625 U Taq-ДНКполимеразы, с добавлением 4 мкл исследуемого образца до конечного объема 25 мкл. ПЦР проводили в программируемом термостате ТП4-ПЦР-01-«Терцик»

(производство ЗАО «НПФ ДНК-Технология»,Россия) используя программу: 1 цикл 95 оС – 2 мин; 30 циклов 94 оС – 45 сек, 55 оС ; 72 оС – 45 сек; 1 цикл 72 оС – 10 мин. Для учета результатов ПЦР проводили электрофорез в 1,5 % агарозном геле при постоянном напряжении 75 В в ТВЕ буфере (0,9 М Tris, 0,9 М борная кислота, 20 мМ EDTA·Na2) с окрашиванием бромистым этидием и последующим фотографированием в проходящем УФ-свете.

Изучение генетических особенностей популяционной структуры иерсиний выполнялось на основе генотипирования гена gyrB, кодирующего В-субъединицу ДНК-гиразы, и гена ompF, кодирующего белок наружной мембраны. Для gyrBгенотипирования геномную ДНК выделяли из штаммов стандартным методом фенол-хлороформной депротеинизации с протеиназой К и коммерческим набором Genomics DNA Purification Kit (производство «Fermentas», Литва).

Видовую идентификацию иерсиний проводили на основе секвенирования и анализа участка гена gyrB [89]. Фрагменты получали с использованием прямого YgyrF 5`-CCCACTTTATACCT-3` и обратного YgyrR 5`-CCCACTTTATACCT-3` праймеров (производство ЗАО «Евроген», г. Москва). ПЦР проводили с использованием «горячего старта» в 25 мкл реакционной смеси с использованием HSТaq- полимеразы (производство «Евроген», Россия). Реакционная смесь содержала 20-50 нг геномной ДНК с конечной концентрацией каждого праймера 0,3 мкМ и 0,2 мМ каждого дНТФ. Амплификацию осуществляли в термоциклере Gene Amp 2700 (производство «Applied Biosystems», США) по программе: 1 цикл 950 С – 5 мин, 40 циклов: 940 С -20 с, 600 С – 20с, 720 С – 30с. Детекцию продуктов амплификации после окрашивания бромистым этидием проводили в 1,5% агарозном геле. ПЦР-фрагменты очищали с помощью коммерческого набора DNA Extraction Kit (производство «Fermentas», Литва) и секвенировали на автоматическом ДНК анализаторе 3130хL («производство Applied Biosystems», США) методом флюоресцентномеченых терминаторов – 2-, 3дидезоксинуклеозидтрифосфатов Big Dye™ с использованием вышеприведенных праймеров.

Последовательности анализировали с использованием программы MEGA v.4. [91]. Филогенетическое дерево построено методом ближайших соседей на основе гена gyrB с использованием последовательностей штаммов иерсиний, представленых в базе данных GeneBank.

Идентификацию патогенных видов рода Yersina осуществляли методом многопраймерной ПЦР на основе выявления гена ompF [43]. ПЦР проводили с использованием «горячего старта». Реакционная смесь содержала 20 нг геномной ДНК, 60 мМ трис-НCl (pH 8,9), 65 мМ KCl, 3,0 мM MgCl2, 0,05% твин-20, по 0,2 мМ каждого дНТФ, по 0,3 мкМ каждого праймера и 0,75 ед. Taq-полимеразы (производство «Сибэнзим», Россия) в 25 мкл раствора. Амплификацию осуществляли при следующих условиях: 1 цикл 950С – 5 мин, 40 циклов: 940С – 20 с, 600С – 20 с, 720С – 15 с. Продукты ПЦР анализировали в 2% агарозном геле после окрашивания бромистым этидием.

Иммунологические методы Для идентификации выделенных культур использовали прямой метод флуоресцирующих антител. Применяли коммерческие «Иммуноглобулины диагностические флуоресцирующие псевдотуберкулезные, адсорбированные лошадиные» (производство ФКУЗ РосНИПЧИ «Микроб», г. Саратов).

Для выявления антигена возбудителя псевдотуберкулеза из органов грызунов (печень, селезенка) использовали метод ИФА с тест-системой «Тест – система иммуноферментная для выявления антигенов иерсиний псевдотуберкулеза I серовара» (производство ФБУН НИИ эпидемиологии и микробиологии имени Пастера, Санкт-Петербург) по прилагаемой инструкции.

Реакция непрямой гемагглютинации (РНГА). Для выявления антител к иерсиниям в ОСК использовали РНГА с коммерческими эритроцитарными диагностикумами: псевдотуберкулезным и кишечноиерсиниозными О:3 и О:9 (производство НИИВС, Санкт-Петербург). РНГА проводили согласно прилагаемым инструкциям.

Иммуноферментный анализ (ИФА). Для выявления иерсиниозных антител в

ОСК методом ИФА использовали:

1) Коммерческие тест-системы «Иерсиниоз-ИФА-IgA», «Иерсиниоз-ИФАIgA», «Иерсиниоз-ИФА-IgM» (производство ООО «Омникс», Санкт-Петербург), Постановку реакций проводили согласно прилагаемым инструкциям.

2) Тест-системы, разработанные в Тихоокеанском институте биоорганической химии ДВО РАН, на основе видо – и родоспецифических белков – поринов НМ Y. рseudotuberculosis и Y. еnterocolitica [9, 35]. Анализ проводили согласно МУ 3.1.1.001-98 «Определение антител в сыворотках людей методом ИФА для диагностики псевдотуберкулеза».

3) Наряду с вышеуказанными методами, в лабораторных условиях сконструирован, с использованием стандартных ингредиентов, дополнительный набор для выявления антител к возбудителю кишечного иерсиниоза [36].

Необходимость получения указанной тест-системы обусловлена тем, что при использовании коммерческих тест-систем для детекции противоиерсиниозных антител, сконструированных на основе Yops иерсиний, нет возможности дифференцировать антитела к Y. pseudotuberculosis от антител Y. enterocolitica.

Для исследования сывороток крови больных применяли непрямой вариант ИФА, используя микропланшеты (производство «Costar», США), в лунках планшета сорбировали антиген в количестве 1 мкг. В качестве антивидовых антител использовали коммерческие иммуноферментные конъюгаты (производство «Invitrogen», США). Результаты учитывали на спектрофотометре Quant (производство «BIO-TEK INSTRUMENTS.INC», США) при 492 нм, в качестве хромогена применяли 0,04% раствор ортофенилендиамина. При определении диагностического титра в ИФА сравнивали результаты анализа индивидуальных и пуловых сывороток здоровых доноров и индивидуальных сывороток крови больных кишечным иерсиниозом с диагнозом, подтвержденным бактериологически при различных разведениях (1/100, 1/200, 1/400, 1/800, 1/1600, 1/3200). Величину, равную отношению средних значений оптической плотности (ОП) продукта ферментативной реакции антигена с сыворотками крови больных иерсиниозом и здоровых доноров при различных разведениях, определяли по формуле: Fоп/Fзд, где Fоп = Fс + Fф, где Fс – значение ОП продукта специфической антиген/антитело (антитела – сыворотка крови здорового или больного человека);

Fф – значение оптической плотности продукта неспецифической фоновой реакции; Fзд – значение оптической плотности продукта реакции антигена с сывороткой здорового донора (отрицательный контроль). Исследуемую сыворотку считали положительной при Fоп/Fзд 2,1. Величины, соответствующие отношению Fоп/Fзд в указанном диапазоне разведний сывороток, оказались равны соответственно 3.6, 4.0, 4.2, 5.5, 5.0, 4.1. За диагностический титр было принято разведение сыворотки крови 1/800-1/1600, при этих титрах можно достоверно дифференцировать патологию, обусловленную Y. enterocolitica.

Эпидемиологические методы Анализ заболеваемости населения в Якутии проводили за период с 2002 г.

по 2012 г. по статистическим данным и историям болезни. Для работы использовали годовые и месячные формы отчета по заболеваемости.

Сопоставление данных о заболеваемости, а также о циркуляции выделенных штаммов иерсиний проведено в Центре гигиены и эпидемиологии в Республике Саха (Якутия) на изучаемых территориях.

Статистическая обработка данных Статистическая обработка данных производилась с помощью пакета программ MS Excel, SPSS (версия 13.0) в соответствии с правилами медицинской статистики [18]. Оценка 95% доверительных интервалов для показателя с бинарным типом шкалы произведена по методу Клоппера-Пирсона, критерий хиквадрат применяли для сравнения категориальных переменных. Гипотезы рассматривались как статистически достоверные при p0,05. Отличия между выборками оценивались по параметрическому критерию Стьюдента. С вероятностью ошибки p0,05 разность результатов исследования считали статистически значимой при числе степеней свободы K=n1+n2-2.

Личное участие автора в получении результатов Автором составлен план исследования, проведен аналитический обзор литературы, выполнен весь объем бактериологических исследований, сформирована выборка исследуемых штаммов; иммунологические исследования ОСК пациентов методами РНГА и ИФА. Исследования проб методом ПЦР, осуществлены автором совместно с бактериологом Романовой И.А. в лаборатории особо опасных инфекций ФБУЗ «Центр гигиены и эпидемиологии в Республике Саха (Якутия)».

Дифференциация вирулентных штаммов, серотипирование, определение генетических детерминант вирулентности проведены совместно с к.б.н.

Воскресенской Е.А. и н.с. Богумильчик Е.А на базе ФБУН НИИ эпидемиологии и микробиологии имени Пастера, г. Санкт-Петербург. Определение родственных связей иерсиний на основе gyrB-генотипирования, исследования ОСК методом ИФА с использованием тест- системы на основе поринов НМ проведено совместно с к.м.н. Исаевой М.П., к.б.н. Портнягиной О.Ю. на базе ФГБУН ТИБОХ ДВО РАН, г. Владивосток. Соискатель провела систематизацию, статистическую обработку полученных данных, сформулировала выводы и практические рекомендации.

Положения диссертации, выносимые на защиту:

На территории Якутия в природных и антропургических очагах 1.

установлено распространение иерсиний 5 видов. Популяции мелких млекопитающих, объекты животного и растительного происхождения инфицированы в подавляющем большинстве Y. enterocolitica биотипов 1А, и биотипов 2 и 4, серотипов О:3; О:9; О:7,8; О:5; О:6,31.

Охарактеризованы патогенные штаммы Y. pseudotuberculosis, Y.

2.

еnterocolitica биотипов 2, 4, выделенные от больных и из объектов окружающей среды, а также Y. еnterocolitica биотипа 1А и Y. kristensenii в качестве возможных этиологически значимых на основании содержания генетических детерминант вирулентности – хромосомных генов термостабильных энтеротоксинов ystB и ykst. Для штаммов Y. еnterocolitica и других видов, выделенных в «условиях вечной мерзлоты», выявлено генетическое разнообразие и экологические особенности: Y. еnterocolitica биотипа 1А формирует собственную генетическую ветвь в пределах вида, а для штаммов Y. kristensenii, Y. intermedia свойственна высокая генетическая гетерогенность, что обусловлено полиморфизмом гена gyrB.

На территории Якутии наблюдается спорадическая заболеваемость 3.

без клинического симптомокомплекса болезни, характерна неравномерность территориального распространения, широкая циркуляция иерсиний на территориях обследования. Разработан алгоритм микробиологического мониторинга циркуляции иерсиний, включающий порядок организации и проведения лабораторной диагностики учреждениями Роспотребнадзора с учетом климатических условий и медико-географических зон территории Якутии.

Степень достоверности и апробация результатов Штаммы, представленные в работе, выделены от больных, животных, с объектов окружающей среды в ходе расследования вспышек кишечного иерсиниоза и/или псевдотуберкулеза, а также спорадических случаев.

Полученные данные обработаны и систематизированы с помощью методов описательной статистики, пакетов компьютерных программ и информационных баз данных и представлены в виде таблиц и графических изображений.

Диссертация апробирована на заседании Ученого совета Федерального бюджетного учреждения науки «Санкт-Петербургский научно-исследовательский институт эпидемиологии и микробиологии им. Пастера», протокол №6 от 24.09.2014 г.

Основные результаты исследований доложены на российских и международных конференциях: III Всероссийской НПК с международным участием «Инфекции, обусловленные иерсиниями» (г. Санкт- Петербург, 2011 г.);

межрегиональной НПК «Инфекционные болезни: вчера, сегодня, завтра» (г.

Якутск, 2012 г.); I Республиканской НПК «Проблемы антибиотикорезистентности в многопрофильном стационаре» (г. Якутск, 2012 г.); V Региональной НПК с международным участием «Актуальные вопросы инфекционной патологии на Дальнем Востоке» (г. Хабаровск, 2012 г.); семинаре по подготовке бактериологов республики на базе Центра гигиены и эпидемиологии (г. Якутск, 2010, 2011, 2012 гг.); семинаре по подготовке кадров специалистов по ветеринарии Якутской государственной сельскохозяйственной академии (г. Якутск, 2010, 2011 гг.);

семинаре по стандартизации лабораторного мониторинга иерсиниозов (НИИЭМ им. Пастера, г. Санкт-Петербург, 2013 г.); конгрессе «Экология и здоровье человека на Севере» (СВФУ г. Якутск, 2013 г.).

Публикации Основное содержание диссертации отражено в 19 печатных работах, в том числе, 4 статей опубликованы в рецензируемых изданиях, 8 – в других изданиях, 7 – в материалах конференций.

Структура и объем диссертации Основной текст диссертации изложен на 123 страницах машинописного текста и состоит из введения, аналитического обзора литературы, 4 глав собственных исследований, заключения, выводов, практических рекомендаций, перспективы дальнейшей разработки, сокращений, литературы. Диссертация содержит 24 таблицы и 11 рисунков. Список литературы содержит 60 источников отечественных и 34 источника зарубежных авторов.

Глава 1. Обзор литературы

1.1. Распространение псевдотуберкулеза и кишечного иерсиниоза в мире и России Y. pseudotuberculosis - возбудитель псевдотуберкулеза, Y. enterocolitica возбудитель кишечного иерсиниоза, широко распространены во многих странах мира, являясь причиной групповой и спорадической заболеваемости. При этом псевдотуберкулез характерен, в основном, для территорий с умеренным и холодным климатом, а кишечный иерсиниоз распространен повсеместно [52].

Псевдотуберкулез соответствует всем основным положениям учения Е.Н.

Павловского о природной очаговости болезней. Как самостоятельная нозологическая единица псевдотуберкулез был признан после сообщения W.

Knapp и W. Masshoff в 1953 г. о группе мезентериальных лимфаденитов псевдотуберкулезной этиологии, то есть, через 70 лет после открытия возбудителя.

Природные очаги этой инфекции существуют во многих странах мира и во всех регионах России, но заболевания среди людей регистрируются с неодинаковой частотой, что обусловлено особенностями эпидемического процесса, и в первую очередь, его приуроченностью к экономически развитым регионам и крупным населенным пунктам. Псевдотуберкулез, впервые описанный И.И. Груниным, Г.П. Сомовым и И.Ю. Залмовером в 1960 г., после вспышки заболевания в марте 1959 г. в одном из коллективов г. Владивостока, расценивался, как дальневосточная скарлатиноподобная лихорадка (ДСЛ).

Различные по интенсивности проявления этой инфекционной болезни регистрировались, кроме России, также в Казахстане, Узбекистане, Армении, на Украине, Белоруссии. Первая за пределами Дальнего Востока групповая вспышка заболевания, сходного с ДСЛ, была выявлена в 1968 году в одном из детских садов Невского района г. Ленинграда, весной 1972 г. [41].

В России регистрируются как групповые заболевания, так и спорадические случаи, практически повсеместно, однако, наблюдается неравномерное распределение заболеваемости по отдельным регионам: наиболее высокие показатели характерны для регионов с умеренным и холодным климатом (Сибирский, Дальневосточный, Северо-Западный) [7, 15, 56].

В последние годы эпидемиологическая ситуация по псевдотуберкулезу в Российской Федерации (РФ) изменилась не только по уровню заболеваемости, но и по особенностям его территориального распространения. В РФ ежегодно регистрируется около 6,5 тыс. случаев псевдотуберкулеза (средний многолетний показатель – 4,5%000). Основная доля заболеваний регистрируется в Сибири (67,2%), на Европейскую часть приходится 25,6%, на Дальний Восток 7,4% [93].

По данным статистики за 2011-2012 гг. в Сибирском федеральном округе (СФО) зарегистрировано 2422 больных псевдотуберкулезом. Среди заболевших преобладают городские жители (около 70%) и дети до 14 лет (более 69%). К территориям с наиболее высоким уровнем заболеваемости псевдотуберкулезом относятся Новосибирская (13,15%000), Томская (11,65%000), Кемеровская (8,65%000) области и Республика Хакасия (8,8%000). Несмотря на общую тенденцию снижения заболеваемости в последние годы в России на отдельных территориях установлен рост числа заболевших: в Красноярском крае, Иркутской области. В 2007 г. зарегистрирована вспышка псевдотуберкулеза в школьном коллективе Ямало-Ненецкого автономного округа [6].

В 2011-2012 гг. зарегистрировано шесть вспышек групповых заболеваний псевдотуберкулезом с общим числом заболевших 62 человека в трех субъектах СФО (Томская, Новосибирская, Иркутская области с бактериологическим подтверждением диагноза в 12,5 – 33,3% случаев). Групповые заболевания возникали также на территориях Республики Бурятия: так, в двух районах республики заболевания регистрировали в детских организованных коллективах, в которых в 2007 – 2008 гг. заболело псевдотуберкулезом 143 человека [48, 54].

В Якутии первая вспышка псевдотуберкулеза была зарегистрирована в сентябре 1974 г. в п. Надежный Мирнинского района. Особенностью первой вспышки явились предшествующие взрывы на промышленных объектах алмазного карьера, в результате которых, наблюдалась резкая миграция грызунов из природных очагов в поселок. Также сероконверсии к возбудителю псевдотуберкулеза определялись при ретроспективном исследовании сывороток крови у местных жителей в центральной Якутии; Нерюнгринском, Чурапчинском, Усть-Алданском, Таттинском районах [15]. В 2000 г. было проведено ретроспективное исследование образцов сывороток людей на наличие антител к псевдотуберкулезу в Субарктике Евразии, в том числе в Анабарском, Булунском, Усть-Янском и Аллаиховском заполярных районах Республики Саха (Якутия). Получены положительные результаты в реакции агглютинации (РА) с антигеном Y. pseudotuberculosis I серовара в 2,14%, 2,43%, 1,26%, 0,9%, соответственно [32].

Пространственное распространение природно-очаговых инфекций (ПОИ), эпидемиологическая значимость их очагов в разных местах Якутии неодинаковы, что обусловлено природными условиями и составом млекопитающих, присущими отдельным территориям зоны. В связи с этим выделены два эпидемиологически значимых района (ЭР): Алданский ЭР и Лено – Олекминский ЭР, в которых зарегистрировны случаи групповых и спорадических заболеваний псевдотуберкулезом и кишечным иерсиниозом.

Кишечный иерсиниоз официально регистрируется с 1992 г.



Pages:   || 2 | 3 | 4 |

Похожие работы:

«Шамонов Николай Алексеевич Разработка промышленной технологии производства пегилированных форм интерферона альфа-2а и альфа-2b 03.01.06 – Биотехнология (в том числе бионанотехнологии) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор медицинских наук, профессор Хамитов Р.А....»

«КАРПЕНКО Анна Юрьевна Изменение трансинтестинальной проницаемости и показателей врожденного иммунитета у онкологических больных в периоперационном периоде 14.03.09 – клиническая иммунология и аллергология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор медицинских наук...»

«Берко Татьяна Владимировна ПРОДУКТИВНОСТЬ И ВОСПРОИЗВОДИТЕЛЬНЫЕ КАЧЕСТВА ПТИЦЫ РОДИТЕЛЬСКОГО СТАДА КРОССА «ХАЙСЕКС КОРИЧНЕВЫЙ» ПРИ ИСПОЛЬЗОВАНИИ В КОРМЛЕНИИ ТЫКВЕННОГО ЖМЫХА, ОБОГАЩЕННОГО БИОДОСТУПНОЙ ФОРМОЙ ЙОДА 06.02.10 – частная зоотехния, технология производства продуктов животноводства ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный...»

«Ядрихинская Варвара Константиновна ЭКОЛОГИЧЕСКИЕ ОСОБЕННОСТИ РАСПРОСТРАНЕНИЯ ОСТРЫХ КИШЕЧНЫХ ИНФЕКЦИЙ В Г. ЯКУТСКЕ И РЕСПУБЛИКЕ САХА (ЯКУТИЯ) 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель кандидат биологических наук, доцент М.В. Щелчкова Якутск 2015...»

«Шемякина Анна Викторовна БИОЛОГИЧЕСКИ АКТИВНЫЕ ВЕЩЕСТВА ДАЛЬНЕВОСТОЧНЫХ ПРЕДСТАВИТЕЛЕЙ РОДА BETULA L. 03.02.14 – Биологические ресурсы Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, профессор Колесникова Р.Д. Хабаровск – 20 СОДЕРЖАНИЕ ВВЕДЕНИЕ.. ГЛАВА 1 ОБЗОР ЛИТЕРАТУРЫ ПО ТЕМЕ ИССЛЕДОВАНИЙ. 1.1 Общие...»

«ТИМОФЕЕВ ВИТАЛИЙ АНАТОЛЬЕВИЧ УДК:594.1:591.4 МОРФОЛОГИЧЕСКИЕ ХАРАКТЕРИСТИКИ ДВУСТВОРЧАТЫХ МОЛЛЮСКОВ-ФИЛЬТРАТОРОВ В СВЯЗИ С УСЛОВИЯМИ ОБИТАНИЯ СПЕЦИАЛЬНОСТЬ 03.02.10 – гидробиология Диссертация на соискание научной степени кандидата биологических наук Научный руководитель Самышев Эрнест Зайнуллинович, доктор биологических наук, професcор Севастополь 2014 Содержание. ПЕРЕЧЕНЬ УСЛОВНЫХ ОБОЗНАЧЕНИЙ ВВЕДЕНИЕ 6 РАЗДЕЛ Состояние...»

«Миронов Андрей Викторович КОРРЕКЦИЯ АККОМОДАЦИОННЫХ НАРУШЕНИЙ У ПАЦИЕНТОВ ЗРИТЕЛЬНО-НАПРЯЖЕННОГО ТРУДА МЕТОДАМИ ФИЗИЧЕСКОГО ВОЗДЕЙСТВИЯ 14.01.07 – глазные болезни 14.03.11 восстановительная медицина, спортивная медицина, лечебная физкультура, курортология и физиотерапия Диссертация на...»

«ШИГАПОВ Иршат Сайдашович ОСОБЕННОСТИ ФОРМИРОВАНИЯ И РАЗВИТИЯ МАЛЫХ ОЗЕР УРБАНИЗИРОВАННЫХ ТЕРРИТОРИЙ (на примере города Казани) 25.00.36 Геоэкология Диссертация на соискание ученой степени кандидата географических наук Научный руководитель: доктор биологических наук, профессор, зав. каф. природообустройства и водопользования, зав. лабораторией оптимизации водных экосистем КФУ МИНГАЗОВА Н.М. Научный консультант: доктор...»

«БРИТАНОВ Николай Григорьевич ГИГИЕНИЧЕСКИЕ АСПЕКТЫ ПЕРЕПРОФИЛИРОВАНИЯ ИЛИ ЛИКВИДАЦИИ ОБЪЕКТОВ ПО ХРАНЕНИЮ И УНИЧТОЖЕНИЮ ХИМИЧЕСКОГО ОРУЖИЯ 14.02.01 Гигиена Диссертация на соискание ученой степени доктора медицинских наук Научный консультант: доктор медицинских наук, профессор...»

«ЗОЛОТОВА Юлия Игоревна ПОЛИМЕРЫ-НОСИТЕЛИ БИОЛОГИЧЕСКИ АКТИВНЫХ ВЕЩЕСТВ НА ОСНОВЕ СОПОЛИМЕРОВ 2-ДЕОКСИ-2-МЕТАКРИЛАМИДО-D-ГЛЮКОЗЫ С N,N-ДИМЕТИЛИ N,N-ДИЭТИЛАМИНОЭТИЛМЕТАКРИЛАТАМИ Специальность 02.00.06 – высокомолекулярные соединения ДИССЕРТАЦИЯ на соискание ученой степени кандидата химических наук Научный руководитель: чл.-корр. РАН, д.х.н., проф. Панарин...»

«КОЛОТВИН АНДРЕЙ ВАСИЛЬЕВИЧ Прогностическая значимость генетического полиморфизма патогена и хозяина для оценки эффективности терапии и развития фиброза печени при хроническом гепатите С Молекулярная биология –...»

«ФЕДОРОВА Екатерина Алексеевна ХАРАКТЕРИСТИКИ ВИРУСА ГРИППА, ВЛИЯЮЩИЕ НА ПОКАЗАТЕЛИ ГУМОРАЛЬНОГО ИММУННОГО ОТВЕТА В ЭКСПЕРИМЕНТЕ И ПРИ ВАКЦИНАЦИИ 03.02.02 – вирусология ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный руководитель: Доктор биологических наук, доцент И.В. КИСЕЛЕВА Санкт-Петербург – ОГЛАВЛЕНИЕ Раздел 1....»

«ПИМЕНОВА ЕКАТЕРИНА ВЛАДИМИРОВНА РАЗРАБОТКА МЕТОДА ОЦЕНКИ ЦИТОТОКСИЧНОСТИ АНТИГЕНОВ ВОЗБУДИТЕЛЯ МЕЛИОИДОЗА IN VITRO НА МОДЕЛИ ПЕРЕВИВАЕМЫХ КЛЕТОЧНЫХ КУЛЬТУР 03.02.03 – микробиология Диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор...»

«СЫРКАШЕВА Анастасия Григорьевна СОВРЕМЕННЫЕ ПОДХОДЫ К ПОВЫШЕНИЮ ЭФФЕКТИВНОСТИ ПРОГРАММ ВСПОМОГАТЕЛЬНЫХ РЕПРОДУКТИВНЫХ ТЕХНОЛОГИЙ У ПАЦИЕНТОК С ДИСМОРФИЗМАМИ ООЦИТОВ 14.01.01акушерство и гинекология Диссертация на соискание ученой степени кандидата медицинских наук Научные руководители: доктор...»

«Палаткин Илья Владимирович Подготовка студентов вуза к здоровьесберегающей деятельности 13.00.01 общая педагогика, история педагогики и образования Диссертация на соискание ученой степени кандидата педагогических наук Научные руководители: доктор биологических наук, профессор,...»

«БИТ-САВА Елена Михайловна МОЛЕКУЛЯРНО-БИОЛОГИЧЕСКОЕ ОБОСНОВАНИЕ ЛЕЧЕНИЯ BRCA1/СНЕК2/BLM-АССОЦИИРОВАННОГО И СПОРАДИЧЕСКОГО РАКА МОЛОЧНОЙ ЖЕЛЕЗЫ Специальности: 14.01.12 – онкология 03.01.04 – биохимия ДИССЕРТАЦИЯ на соискание ученой степени доктора медицинских наук Научный консультант: заслуженный деятель науки РФ, д.м.н., профессор, член-корр. РАН В.Ф. Семиглазов Научный консультант:...»

«Забелина Ольга Николаевна Оценка экологического состояния почвы городских рекреационных территорий на основании показателей биологической активности (на примере г. Владимира) 03.02.08 – экология (биология) Диссертация на соискание ученой степени кандидата...»

«КУДРЯШОВА ЛЮДМИЛА ЮРЬЕВНА ОСОБЕННОСТИ БИОЛОГИИ АМЕРИКАНСКОГО ТРИПСА ECHINOTHRIPS AMERICANUS MORGAN И ПРИЁМЫ БОРЬБЫ С НИМ В ОРАНЖЕРЕЯХ СЕВЕРО-ЗАПАДА РФ Специальность 06.01.07 – Защита растений ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный руководитель: доктор сельскохозяйственных наук, профессор, заслуженный...»

«Доронин Максим Игоревич ЭКСПРЕСС-МЕТОДЫ ВЫЯВЛЕНИЯ ВИРУСА ИНФЕКЦИОННОГО НЕКРОЗА ГЕМОПОЭТИЧЕСКОЙ ТКАНИ ЛОСОСЕВЫХ РЫБ 03.02.02 «Вирусология» Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, Мудрак Наталья Станиславовна Владимир 2015 ОГЛАВЛЕНИЕ 1 ВВЕДЕНИЕ 2 ОБЗОР ЛИТЕРАТУРЫ 2.1 Характеристика возбудителя инфекционного...»

«АБДУЛЛАЕВ Ренат Абдуллаевич ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ МЕСТНЫХ ФОРМ ЯЧМЕНЯ ИЗ ДАГЕСТАНА ПО АДАПТИВНО ВАЖНЫМ ПРИЗНАКАМ Шифр и наименование специальности 03.02.07 – генетика 06.01.05 – селекция и семеноводство сельскохозяйственных растений ДИССЕРТАЦИЯ на соискание учёной степени кандидата...»







 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.