WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 


Pages:   || 2 | 3 |

«СТРУКТУРНО-ФУНКЦИОНАЛЬНЫЕ РАЗЛИЧИЯ ЦИТОПЛАЗМАТИЧЕСКИХ ИЗОФОРМ АКТИНА В НЕМЫШЕЧНЫХ КЛЕТКАХ ...»

-- [ Страница 1 ] --

На правах рукописи

ДУГИНА ВЕРА БОРИСОВНА

СТРУКТУРНО-ФУНКЦИОНАЛЬНЫЕ РАЗЛИЧИЯ

ЦИТОПЛАЗМАТИЧЕСКИХ ИЗОФОРМ АКТИНА В

НЕМЫШЕЧНЫХ КЛЕТКАХ

Специальность 03.03.04 – клеточная биология, цитология,

гистология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

доктора биологических наук

Москва – 2014

Работа выполнена в отделе математических методов в биологии НИИ физикохимической биологии имени А. Н. Белозерского Федерального государственного бюджетного образовательного учреждения высшего профессионального образования «Московский государственный университет имени М. В. Ломоносова»

Официальные оппоненты:

Лагарькова Мария Андреевна, доктор биологических наук, заведующая лабораторией генетических основ клеточных технологий Федерального государственного бюджетного учреждения науки «Институт общей генетики им. Н.И. Вавилова» РАН Лепеха Лариса Николаевна, доктор биологических наук, профессор, заведующая лабораторией патоморфологии Федерального государственного бюджетного учреждения «Центральный научноисследовательский институт туберкулеза» РАМН Ширинский Владимир Павлович, доктор биологических наук, профессор, директор института экспериментальной кардиологии Российского Кардиологического Научно-производственного Комплекса Министерства здравоохранения Российской Федерации

Ведущая организация: Федеральное государственное бюджетное учреждение науки «Институт биологии развития им. Н. К. Кольцова РАН»

Защита диссертации состоится «16» декабря 2014 года в 15:30 на заседании совета Д.501.001.52 по защите докторских и кандидатских диссертаций при Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования «Московский государственный университет имени М. В. Ломоносова» по адресу 119899, Москва, Ленинские горы, МГУ, д.1, стр.12, Биологический факультет, аудитория М-1.

С диссертацией можно ознакомиться в Научной библиотеке МГУ имени М.В.

Ломоносова (Фундаментальная библиотека, Ломоносовский проспект, д.27) и на сайте биологического факультета www.bio.msu.ru.

Автореферат разослан « » сентября 2014 года.

Ученый секретарь диссертационного совета, кандидат биологических наук Калистратова Е.Н.

ОБЩАЯ ХАРАКТЕРИСТИКА ДИССЕРТАЦИИ

Актуальность темы исследования. Актины - основные структурные компоненты цитоскелета эукариотических клеток. Актиновые микрофиламенты выполняют различные функции, большинство из которых связано со способностью к сборке и разборке филаментозных структур. Актомиозиновые структуры осуществляют сократительные и двигательные функции клеток. Актиновая система отвечает за клеточную подвижность, которая лежит в основе тканеобразования в процессе эмбриогенеза и дальнейшего развития многоклеточных организмов.

Реорганизации актинового цитоскелета необходимы для осуществления нормальных биологических процессов заживления ран, регенерация тканей, иммунного ответа.

Патологическое изменение подвижности клеток с нарушением регуляции актиновой системы происходит при воспалительных, фибросократимых, сердечнососудистых заболеваниях, при опухолевой инвазии и метастазировании. Нарушение в организации актиновой систем приводит к изменению упорядоченности и ориентации, неконтролируемому росту клеток, неправильному ответу на внешние стимулы, опухолевой трансформации (Prasad, 2005; Yamaguchi, Condeelis, 2007).

Изучение процессов реорганизации актинового цитоскелета, определяющих клеточную подвижность в норме и при опухолевой трансформации, а также механизмов, специфически регулирующих эти процессы, является фундаментальной научной проблемой, на решение которой были направлены исследования автора.

Высшие позвоночные продуцируют 6 изоформ актина: 4 мышечных и 2 немышечных. Мышечные актины тканеспецифичны, их экспрессия и строгая регуляция в процессе развития и дифференцировки предполагает функциональную значимость изоформ. Функциональная роль -гладкомышечного актина (-SMA), который может экспрессироваться и в немышечных клетках, была изучена недостаточно. В немышечных клетках экспрессируются две основные изоформы и -цитоплазматические актины (- и -CYA), различающиеся только по 4 аминокислотам на NH2-конце. Цитоплазматические актины играют ведущую роль в ключевых клеточных процессах, таких как адгезия, миграция, поляризация, митоз.

Патологические изменения подвижности клеток с нарушением регуляции актиновой системы происходят при опухолевой трансформации, они приводят к инвазии и метастазированию. Функциональные различия - и -CYA в нормальных и неопластически трансформированных клетках не были изучены. Понимание механизмов селективной регуляции изоформ актина необходимо для поиска новых путей диагностики и избирательного воздействия на инвазивные и метастатические свойства опухолевых клеток, а также направленного воздействия на системы цитоскелета, связанные с другими патологиями и заболеваниями человека.

Степень разработанности темы исследования. Сопоставление полученных результатов с мировым уровнем. Топографическое распределение и функциональные различия между - и -CYA ранее известны не были. Механизмы построения и реорганизации разнообразных актиновых структур были изучены недостаточно. Известно, что малые ГТФ-азы семейства Rho отвечают за образование различных структур, связанных с клеточным движением. Обнаружено, что актиновые системы, построенные из разных CYAs, находятся под контролем разных малых ГТФаз семейства Rho.

В данной работе впервые показана топографическая, структурная и функциональная разница между CYAs в клетках млекопитающих. Характер подвижности (скорость и направленность движения) нормальных фибробластов, лишенных - или -CYA, различается, т.е. CYAs играют разные роли в клеточной подвижности. С помощью специфического уменьшения экспрессии CYAs методом РНК-интерференции (siRNA) продемонстрирована преобладающая роль -CYA в направленном движении клеток (Dugina et al., 2009). Локализация мРНК -CYA на ведущем крае связывают с направленным движением нормальных клеток (Condeelis, Singer, 2005). У опухолевых клеток та же локализация редуцирует хемотактически зависимую подвижность, инвазивность и метастатический потенциал (Lapidus et al., 2007).

С представленными результатами согласуются данные, полученные на клетках нейробластомы:

-CYA siRNA блокирует их миграцию (Shum et al., 2011). Угнетение миграционного потенциала эмбриональных фибробластов с выключенным геном ACTB происходит из-за компенсаторной экспрессии -SMA и повышения сократимости, ингибирование которой восстанавливало миграционную способность клеток без -CYA, но с -CYA (Tondeleir et al., 2012).

При опухолевой трансформации происходит реорганизация актинового цитоскелета, ведущая к изменению клеточной подвижности. Отмечена корреляция между исчезновением актиновых стресс - фибрилл и повышением миграционной активности и/или метастатического потенциала опухолевых клеток (Pokorna et al., 1994; Sahai, Marshall, 2003). Описано изменение мышечных изоформ актина в некоторых опухолях, а также исчезновение -SMA при опухолевой трансформации (Leavitt et al., 1985; Okamoto-Inoue et al., 1990). Дальнейшее исследование изменений распределения и экспрессии изоформ актина, а также их регуляции в нормальных и опухолевых клетках, было важно для понимания функций изоформ.

Цель и задачи исследования. Целью данной работы было установить потенциальные морфологические и функциональные различия изоформ актина в нормальных и неопластически трансформированных фибробластах и эпителиальных клетках.

Для достижения поставленной цели были сформулированы следующие экспериментальные задачи:

1. Сравнить морфологические и цитоскелетные характеристики фибробластов различного тканевого происхождения в зависимости от экспрессии -SMA в стрессфибриллах.

2. Исследовать изменения актинового цитоскелета и фокальных контактов (ФК) в зависимости от индукции -SMA на модели дифференцировки миофибробластов под действием ростового фактора TGF- в культуре.

3. Получить данные о взаимной пространственной локализации белков ФК, изоформ актина, клеточного фибронектина (ED-A FN), а также рецепторов к фибронектину (FN) – интегринов, с помощью лазерной сканирующей микроскопии (LSM) с последующей трехмерной реконструкцией изображения.

4. Исследовать функциональную роль -SMA в миофибробластах с помощью ингибирования NH2-концевым декапептидом -SMA, а также специфическими ингибиторами актомиозинового взаимодействия.

5. Сопоставить структурное и пространственное распределение - и -CYA в фибробластах и эпителиальных клетках с помощью LSM, используя моноклональные антитела (mAbs) и специфические ингибиторы Rho/Rac сигнальных путей и актиновой полимеризации.

6. Охарактеризовать морфо-функциональные различия между CYAs в фибробластах и эпителиальных клетках с помощью метода siRNA с избирательным уменьшением экспрессии - и -CYA.

7. Исследовать распределение - и -CYA в нормальных и неопластически трансформированных клетках различных моделей в культуре. Провести сравнение взаимной организации CYAs в нормальной и опухолевой ткани молочной железы и шейки матки человека.

Научная новизна, теоретическая и практическая значимость. В результате проведенного анализа организации актиновых структур с использованием LSM и других современных методов клеточной биологии впервые установлены морфофункциональные различия между изоформами актина в немышечных клетках.

Показано, что экспрессия -SMA и включение его в состав пучков микрофиламентов вызывает увеличение размеров ФК (созревание). Впервые описана особая стадия развития ФК – формирование «суперзрелого» ФК. С помощью LSM с 3D реконструкцией изображения исследована и описана структура «суперзрелого» ФК и условия его возникновения. Показана строгая зависимость формирования «суперзрелых» ФК от молекулярного состава стресс-фибрилл и ECM. При образовании «суперзрелых» ФК необходимыми условиями являются синтез и встраивание в пучок -SMA, ответственного за повышенную сократимость.

Впервые показано, что - и -CYA по-разному локализованы в нормальных мезенхимальных и эпителиальных клетках, и что они образуют различные филаментозные структуры. Впервые при сравнительном изучении клеток различной степени неопластической трансформации проведен анализ организации актиновых структур с использованием LSM с применением 3D реконструкции изображения.

Полученные результаты не имели аналогов в литературе. Топографическое распределение и функциональные различия между этими двумя изоформами ранее не были известны. Сравнительного морфологического исследования изоформ актина, а именно изменений в распределении и экспрессии CYAs, исследования регуляции CYAs в нормальных и опухолевых клетках ранее не проводилось.

Проведенные в данной работе эксперименты внесли существенный вклад в исследования в данной области. Впервые были проведены функциональные эксперименты с помощью NH2-концевых пептидов, специфических низкомолекулярных ингибиторов, а также метода siRNA с избирательным уменьшением экспрессии одной из изоформ актина при сохранении экспрессии другой изоформы в нормальных фибробластах и эпителиальных клетках. Сочетание функциональных исследований после уменьшения экспрессии CYAs и метода LSM с одновременным использованием нескольких флуоресцентных маркеров дали уникальную возможность исследования динамики и структуры актинового цитоскелета клетки в норме и при патологических изменениях. Использованные подходы по сочетанию молекулярно-биологических и других современных методов клеточной биологии соответствуют мировому уровню.

Впервые показана связь трансформации клетки с реорганизациями CYAs и модуляциями в их экспрессии. Результаты, полученные в условиях культивирования нормальных и трансформированных клеток, а также в иммуногистохимических исследованиях нормальной и опухолевой ткани молочной железы и шейки матки человека позволяют предположить, что уменьшение экспрессии -CYA при сохранении гомогенного распределения -CYA можно считать характерным признаком опухолевой трансформации. Результаты данной работы свидетельствуют о перспективности дальнейших исследований молекулярных механизмов регуляции цитоскелетных систем, построенных из различных изоформ актина.

Данное исследование имеет не только теоретическое, но и важное практическое значение. Обнаружена фенотипическая нормализация трансформированных и опухолевых клеток разного происхождения под воздействием митохондриальнонаправленных антиоксидантов группы SkQ, что позволяет рассматривать вещества этой группы как потенциальные средства превентивной и поддерживающей противоопухолевой терапии.

Результаты исследования предполагают возможность использования специфических mAbs к изоформам актина в качестве дополнительных иммуногистологических маркеров для дифференциального диагноза между доброкачественными и злокачественными новообразованиями молочной железы, шейки матки и других онкологических заболеваний.

Методология исследования. Изучение структуры и динамики актинового цитоскелета, играющего ведущую роль в клеточной подвижности, проводится в течение многих лет, но отсутствие специфических mAbs к -CYA не позволяло ранее проводить сравнительное исследование изоформ актина. Из предыдущих исследований возникла гипотеза о том, что: 1) спектр актиновых изоформ, мышечных и немышечных, может определять морфологические свойства, тип адгезионных структур и другие параметры, связанные с распластыванием и движением клеток; 2) возможно существование морфо-функциональных различий между изоформами актина. Использование спектра новых специфических mAbs к изоформам актина, методов двумерного (2D) электрофореза и иммуноблоттинга белков, функциональноблокирующих пептидов и специфических ингибиторов, применение LSM позволило детально исследовать эти различия. При исследовании формирования и реорганизации актиновых структур использована прижизненная LSM клеток, трансфицированных плазмидами, несущими ДНК различных актиновых изоформ и белков ФК, соединенных с флуорохромами и классическая имунофлуоресценция с широким спектром Abs. При исследовании регуляции реорганизации CYAs в клетке важные результаты были получены при помощи специфического уменьшения экспрессии CYAs методом siRNA. Иммуноморфлогическое исследование тканевых срезов дополнило данные, полученные в условиях культивирования клеток.

Степень достоверности и апробация результатов работы. Основные результаты были представлены на всероссийских конференциях: 2-м съезде биофизиков России (1999); “Цитоскелет и клеточная регуляция” (Пущино, 2000);

«Биология клетки в культуре» (С.-Петербург, 2003, 2006); «Молекулярные механизмы процессов онтогенеза: эмбриогенез, геномы, эволюция» (Москва, 2006);

«Фундаментальная онкология – Петровские чтения» (С.-Петербург, 2006, 2008, 2009);

XIII Российском онкологическом конгрессе (Москва, 2009); Школе-семинаре по проблемам организации внутриклеточного транспорта, цитоскелета и путей передачи сигнала (С.-Петербург, 2009, 2011); на международных конференциях: “Mechanisms involved in tissue repair and fibrosis” (Лион, 1997); 14th Meeting of ECF (Оэрас, 1999);

17th Meeting of ECF (Нион, 2002); Gordon Research Conference on Tissue Repair and Regeneration, 2003; 18th ECF Meeting-EMBO/FEBS (Госау, 2003); «From Cell Biology to Development and Disease», FEBS (Хельсинки, 2004); “Tissue Repair, Contraction and the Myofibroblast” (Нион, 2004); FEBS-ESF “Integrated Approaches in Cytoskeleton Research” (Люксембург, 2005); SGED/SSED Annual Meeting (Берн, 2005); Swiss Biomedical Research SSEB Annual Meeting (Женева, 2006); CIBMG1 (Тунис, 2007);

ASCB-ECF (Дижон, 2007); FEBS “Mechanics and Dynamics of the Cytoskeleton” (Потсдам, 2008); SEB-ECF "The Cytoskeleton in Cell Morphogenesis" (Дюрам, 2009);

ECF/EMBO «The Cytoskeleton in Development and Pathology» (Стокгольм, 2010);

«Биологическая подвижность» (Пущино, 2010); International Workshop (Жиф-сюрИветт, 2010); ECF “Actin-based motility. From molecules to model organisms” (2011);

37th FEBS (Севилья, 2012); ECF “The cytoskeleton in tissue repair and diseases” (Фрибург, 2013); научных конференциях НИИ канцерогенеза РОНЦ РАМН и НИИ ФХБ им.А.Н. Белозерского МГУ им. М.В. Ломоносова; Ученом Совете НИИ ФХБ им.

А.Н.Белозерского МГУ им. М.В. Ломоносова 02.12.2013 г.; Московском семинаре по клеточной биологии в МГУ им. М.В. Ломоносова 02.04.2014 г.

Достоверность полученных результатов подтверждается публикациями в рецензируемых научных журналах, показателями их цитируемости в системах Web of Science (543) и Scopus (634).

По теме диссертации опубликовано 74 печатные работы, из них статей в российских и международных журналах, соответствующих перечню ВАК РФ - 20, обзорных глав в сборниках – 2, тезисов докладов в журналах и материалах конференций – 52.

Непосредственное участие автора заключалось в планировании и организации исследований, методической разработке и постановке экспериментов, компьютерной обработке и анализе результатов исследований, написании статей. Соавторы указаны в публикациях.

Структура и объем диссертации. Диссертация изложена на 235 страницах машинописного текста, содержит 79 рисунков, 9 таблиц.

Состоит из разделов:

«Введение», «Обзор литературы», «Материалы и методы», «Результаты исследования и обсуждение» в 4-х частях, «Заключение», «Выводы», «Список литературы».

Библиография включает 458 ссылок.

В результате выполнения диссертационной работы были сформулированы следующие ПОЛОЖЕНИЯ, ВЫНОСИМЫЕ НА ЗАЩИТУ:

ПОЛОЖЕНИЕ 1:

-SMA-позитивные и -SMA-негативные варианты фибробластов, культивируемых из различных органов и тканей, обладают важными фенотипическими отличиями. Экспрессия -SMA и включение его в состав стрессфибрилл вызывает увеличение размеров ФК (созревание). Для образования ФК необходимо комплексное формирование сети «суперзрелого»

внеклеточного матрикса, адгезионных структур и актиновых стресс-фибрилл. Таким образом, формирование и поддержание структуры «суперзрелого» ФК у миофибробластов определяется -SMA-зависимой сократимостью.

ПОЛОЖЕНИЕ 2: В нормальных фибробластах и эпителиальных клетках происходит сегрегация CYAs, наиболее выраженная при реорганизациях актинового цитоскелета; - и -CYA образуют различные структуры в клетке. В нормальных немышечных клетках существуют функциональные различия между CYAs.

ПОЛОЖЕНИЕ 3: При неопластической трансформации происходит нарушение системы -CYA содержащих пучков при сохранении густой кортикальной и ламеллиподиальной сети -CYA микрофиламентов.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

–  –  –

Культивирование клеток и реагенты. Первичные культуры подкожных фибробластов человека (HSCF), мышей и крыс были получены из эксплантов тканевых образцов. Эпителиальные линии: PtK2 кенгуровой крысы; MDCK нормального эпителия почки собаки; HaCaT кератиноцитов человека и их RASтрансформированные производные; C-33A, SiHa, Caski рака шейки матки.

Мезенхимальные линии: эмбриональные легочные фибробласты человека WI38 и их SV-40 - производные WI38-VA13; MRC5 и их SV-40 - клональные производные MRC5-V1 и MRC5V2, эмбриональные легочные фибробласты человека (HEL), крысиные эмбриональные фибробласты REF-52, Rat-1, Rat-2; клонированная сублиния мышиных спонтанно трансформированных фибробластов 152/15. Клетки культивировали в стандартных условиях.

Клетки при распластывании инкубировали с селективными ингибиторами Rhoкиназы (Y-27632, 10 мкM, 2 ч), Rac1 ГДФ/ГТФ активности (NSC23766, 50-100 мкM, 4 ч), немышечного миозина II (блеббистатин, 25 мкM, 4 ч), N-WASP (вискостатин, 5мкM, 30 мин) и с агентами, нарушающими полимеризацию актина (цитохалазин Д, CD, 0,1 мкM, 30 мин и латрункулин А, 0,1-0,2 мкM, 30 мин). Ингибиторы добавляли в конце 7 ч периода распластывания. В экспериментах на легочных фибробластах: ингибитор актомиозиновых взаимодействий БДМ (2,3-бутандион- 2моноксим, 30 мкМ, 3 ч); ингибитор киназы легких цепей миозина МЛ-7 (1-(5йодонафтален-1-сульфонил)-1H-гексогидро-1,4-диазепин гидрохлорид, 20 мкМ, 3 ч).

Для индукции миофибробластной дифференцировки использовали TGF1/2, 5нг/мл.

Специфические MAPK ингибиторы: активации MEK-1, PD098059, 5-50 мкM;

SB203580, p38 MAPК, 20-50 мкM. Клетки инкубировали в среде без сыворотки с MAPK ингибиторами 4 ч до добавления TGF. Опухолевый промотор 12-Oтетрадеканоил-форбол-13-ацетат (ТФА, 2-5 нг/мл). Рекомбинантный мышиный HGF/SF (1нМ) был очищен из клеток мышиной миеломы (Dugina et al., 1995). Для стимуляции ЭМП в культурах карцином шейки матки человека использовался эпидермальный фактор роста (ЭФР, 5-10 нМ). Митохондриально-направленные антиоксиданты SkQ1 (10-(6’-пластохиноил) децилтрифенилфосфоний) и SkQR1 (10пластохиноил) децилродамин 19) («Митотехнологии», 10-40 нМ).

Иммунофлуоресцентная микроскопия. mAbs: мышиные IgG2a к -SMA ( SM-1, Skalli et al., 1986), IgG1 к винкулину (VIN-11-5, Sigma), IgG1 к паксиллину (Transduction Laboratories), IgG2b к тензину и IgG1 к FAK (Transduction Laboratories);

SAM-1, IgG2b к 51 интегрину; IgG1 к ED-A FN (Ist-9); кроличьи поликлональные

Abs к: FN (Sigma); 51 интегрину; -74 к -CYA (Yao et al., 1995). Вторые Abs:

FITC и TRITC-конъюгированные антимышиные IgG2a, IgG2b и IgG1 (Southern Biotech.), FITC, TRITC, AlexaTM488 - конъюгированные антимышиные и антикроличьи IgG (Jackson, Molecular Probes); Texas Red (Anawa) и AlexaTM488стрептавидин - для детекции биотинилированного rED-A фрагмента. Для выявления F-актина: FITC- и AlexaTM488-конъюгированный фаллоидин. Микроскопы: Zeiss Axiophot, объектив Plan-Neofluar 40x/1,3; Axioplan, объектив Plan-Neofluar 40х/0,75 и 100x/1,3 (Zeiss).

Морфометрия клеток и фокальных контактов. Культуры фибробластов окрашивали mAbs к -SMA для определения -SMA- позитивных и негативных клеток. Контуры клеток получали с использованием фотоувеличителя и вводили в PCAT компьютер с помощью цифрового планшета (Summasketch II, Summagraphics, UK). TRACER V1.0 (Copyright Dr. A. Brown). По контурам определяли математические характеристики формы клеток: площадь проекции, занимаемую клеткой на субстрате, периметр и отношение периметра к площади, индексы элонгации и дисперсии (Dunn, Brown, 1986). Для морфометрии ФК клетки окрашивали mAbs к винкулину и -SMA. Морфометрия краевых ФК проводилась с использованием микроскопа Leitz Aristoplan по негативным фото-изображениям, а также по одиночным конфокальным оптическим срезам.

Лазерная Сканирующая Конфокальная микроскопия. Клетки отмывали DMEM с 20мM Hepes при 37°C, фиксировали в 1% PFA на DMEM/Hepes при 30-25°C 15 мин, затем 5 мин MeOH при -20°C. Первые Abs: мышиные анти--CYA (4C2, IgG1), -CYA (2A3, IgG2b); -CYA (AC-74, IgG2a, Sigma); -SMA (SM-1); VASP (IE273, ImmunoGlobe); тропомиозин (TM311, Sigma); Е-кадгерин (BD Transduction);

виментин (V9, DAKO) и кроличьи поликлональные Abs к: p34-Arc (Upstate), спектрину (Biomakor) и немышечному миозину IIA (MHC-A, Covance); вторые Abs:

козьи антимышиные IgG1, IgG2b с FITC и TRITC (Southern), IgG, IgG1, IgG2b Alexa488 (Molecular Probes) и козьи антикроличьи IgG TRITC (Jackson). DRAQ5 (Biostatus), DAPI (Sigma) - для выявления ДНК. LSM 410, LSM510 (Zeiss) с объективами Plan-Neofluar 63x/1,4; Plan-Fluar 100x/1,45. Обработка изображения:

LSM5-Image Examiner. 3D-реконструкция: программы IMARIS.

Трансфекция siRNA.

Последовательность - мишень siRNA -CYA человека (NM_001101) [-CYA siRNA1: AATGAAGATCAAGATCATTGC; -CYA siRNA2:

TAGCATTGCTTTCGTGTAAAT и -CYA siRNA 3: CAAATATGAGATGCATTGTTA]

и -CYA (NM_001614) [-CYA siRNA 1: AAGAGATCGCCGCGCTGGTCA и -CYA siRNA 2: CAGCAACACGTCATTGTGTAA] (Qiagen). Не достигшие монослоя клетки в среде OptiMEM без сыворотки и антибиотиков трансфицировали 50-100 нM siRNA с помощью Lipofectamine 2000 (Invitrogen). Эффективность трансфекции (80-90%) оценивали по совместной трансфекции с флуоресцентным BLOCK-iT™ (Invitrogen).

Морфометрия клеток в экспериментах с siRNA. HSCF трансфицировали с siRNA, через 2 сут пересаживали на покровные стекла, фиксировали и окрашивали на

- и -CYA через 3 сут после трансфекции. Для морфометрии контуров клеток после siRNA трансфекции (площади поверхности, периметра и циркулярности (4A/P2)) использовали программу ImageJ (NIH, http://rsb.info.nih.gov/ij/).

Прижизненная микроскопия после siRNA трансфекции. Прижизненную микроскопию проводили на микроскопе Axiovert 100M (Zeiss) при 37°C в 5% CO2, с использованием CCD камеры (Hamamatsu Photonics) с Openlab software. HSCF трансфицировали с 50 нM siRNA и 50 нM BLOCK-iT™ Fluorescent Oligo (Invitrogen) для маркировки трансфицированных клеток. Анализ кимограмм проводили на чашках со стеклянным дном (MatTek), изображения сохраняли каждые 2 сек в течение 5 мин.

Кимограммы из последовательности изображений получали (Hinz et al., 1999) с помощью программы Metamorph. Длительные наблюдения за подвижностью клеток проводили на ImageXpressMicro при 37°C с 5% CO2. Через 2 сут после трансфекции с 50 нM siRNA и 50 нM BLOCK-iT™, HSCF сажали с низкой плотностью на чашки Costar

3904. Изображения сохраняли каждые 5 мин в течение 13 час, объектив 10x/0.50 (W.D 1,20 mm S Fluor, Nikon). Если клетки входили в митоз или покидали поле зрения в течение эксперимента, то они не учитывались при анализе результатов. Средняя скорость (мкм/час, длина трека/время эксперимента), скорость (мкм/час, только в периоды движения), общая и кратчайшая дистанции определялись по положению ядра клетки с использованием функции Track Point. D/T - кратчайшее расстояние от стартовой до конечной точки (D)/длина трека (T).

Характеристика mAbs к CYAs. Мышей иммунизировали N-концевым пептидом или

-CYA -CYA (Ac-DDDIAALVV) (Ac-EEEIAALVI), конъюгированными с гемоцианином. Отобранные методом ELISA гибридомы были дважды клонированы, охарактеризованы на криостатных тканевых срезах и иммуноблоттингом (Dr. Chaponnier, университет г. Женевы). Блокирующие эксперименты с N-концевым пептидом -CYA проведены на тканевых срезах (иммунофлуоресценция) и экстрактах аорты (иммуноблоттинг). Электрофорез и иммуноблоттинг проводили также с БСА-конъюгированными пептидами 6-ти изоформ.

Электрофорез белков и иммуноблоттинг. Белки экстрагировали в буфере для SDS-PAGE или в Iso буфере для 2D-GE. Мембраны инкубировали с mAbs анти-: CYA (4C2), -CYA (2A3), -SMA (анти-sm-1, 1A4), актин (пан-актин, C4), виментин (V9, Dako), -тубулин (B-5-1-2, Sigma); затем - с HPR-конъюгированными антимышиными Ig козы (Jackson). Для проявления использовали систему ECL.

Cканирование изображений и денситометрический анализ проводили с помощью программ Optiquant и ImageJ.

Статистический анализ. Результаты представлены как среднее ± стандартная ошибка среднего; данные получены, по крайней мере, по 3-м независимым экспериментам. Статистический анализ проводили с помощью t-теста. Значения p0.001 (***), p0.01 (**) и p0.05 (*) считали статистически значимыми.

Сравнительное иммуноморфологическое исследование нормальной и опухолевой ткани молочной железы человека. Были исследованы образцы опухолей 99 пациентов, перенесших частичную или радикальную мастэктомию в РОНЦ РАМН в 1995-2008 гг., без предварительной терапии. Диагностику проводили согласно Международной классификации, предложенной экспертами ВОЗ. По клинико-лабораторным данным РОНЦ образцы были разделены на группы по характеру экспрессии РЭ (рецептор эстрогена), РП (рецептор прогестерона) и HERneu (рецептор эпидермального фактора роста 2 Neu, продукт онкогена ErbB2).

Использовали серийные (5 мкм) срезы: криостатные (1% PFA 15 мин, MeOH C, 5 мин) и архивного материала (формалин-парафин). Демаскировку антигенов проводили в 0,01 M TRIS/0,001M EDTA pH 9,0 в микроволновой печи, 20 мин/95°C (для актинов) и 95-100°C (для кератинов). Мышиные mAbs: к -CYA (4С2); -CYA (2A3); -SMA (SM-1); кератину 8 (К8, H1, IgG1), кератину 17 (К17, E3, IgG2b);

кератину 5/6 (К5/6, Dako) и р63 (4А4, BioGenex). Исследование проводили с помощью непрямой иммунофлуоресценции и пероксидазной техники (En Vision, Dako), микроскопа Axioplan (Zeiss) с объективами 20х/0,50 и 40х/0,75 Plan-Neofluar.

Сравнительное иммуноморфологическое исследование нормальной и опухолевой ткани шейки матки. Исследованы образцы опухолей 53 пациентов ФГБУ РОНЦ РАМН после оперативного вмешательства, без предварительной терапии. Гистологическая диагностика проведена согласно Международной классификации (Benedet et al., 2000). Иммуноморфологическое исследование проводили методом непрямой иммунофлуоресценции и пероксидазной техники.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ОБСУЖДЕНИЕ

ЧАСТЬ 1. Исследование цитоскелетных характеристик и организации адгезионных структур -SMA – позитивных и -SMA – негативных культивируемых крысиных фибробластов различного происхождения

-SMA экспрессируется в фибробластах in vivo в процессе заживления ран и в большой степени коррелирует с сокращением поверхности раны. Присутствие в культуре клеток, экспрессирующих и не экспрессирующих эту изоформу актина (SMA – позитивных и -SMA – негативных клеток) в различных пропорциях, является характеристикой популяции фибробластов из определенных органов и тканей.

Возможно, механизмы, контролирующие экспрессию изоформ актина, играют основную роль в организации формы клетки, адгезионных характеристик и подвижности. Мы сравнили характеристики формы клеток, цитоскелета и организацию контактных структур в -SMA – позитивных и негативных крысиных фибробластах из различных органов или тканей. Внутри каждой категории, т.е. в SMA – позитивных или негативных фибробластах (по иммунофлуоресцентному окрашиванию моноспецифическими mAbs к -SMA), не было обнаружено значительных морфологических отличий по изучаемым признакам между популяциями различного тканевого происхождения.

Напротив, -SMA–позитивные и негативные фибробласты значительно различались, независимо от их происхождения:

-SMA – позитивные клетки занимали большую среднюю площадь на субстрате, имели большее количество узких выростов на краях клеток, большие размеры ФК и более выраженную сеть FN, чем -SMA – негативные фибробласты. Т.о., -SMA – позитивные и негативные варианты, присутствующие в стандартных условиях культивирования в популяциях фибробластов, обладают важными фенотипическими отличиями, возможно, связанными с различной функциональной активностью систем актинового цитоскелета.

Морфометрия -SMA – позитивных и -SMA – негативных клеток в популяциях фибробластов различного происхождения. Морфология -SMA – позитивных клеток отличалась от таковой у -SMA – негативных клеток во всех изученных популяциях фибробластов.

Форма края -SMA – негативных клеток была гладкая, а -SMA – позитивные клетки имели противоположные характеристики:

многочисленные узкие выросты и инвагинации края. Средние площади, занимаемые клетками на субстрате, и периметры у -SMA – негативных были значительно меньше, чем у -SMA – позитивных фибробластов во всех изучаемых культурах.

При использовании нового критерия для характеристики изрезанности края – количество тонких пальцеобразных выростов, “capes”, различия в форме края клетки между -SMA–негативными и позитивными фибробластами становились более очевидными: среднее количество “capes” у -SMA – позитивных клеток было значительно больше, чем у -SMA–негативных в разных популяциях фибробластов.

Цитоскелетные структуры и фокальные контакты (ФК) у -SMA – позитивных и -SMA – негативных клеток в популяциях фибробластов различного происхождения. Иммунофлуоресцентное окрашивание фибробластов на F-актин и -SMA показало, что в -SMA – позитивных клетках эта изоформа актина локализована преимущественно в стресс-фибриллах. Стресс-фибриллы выявлялись как в -SMA – позитивных, так и в -SMA – негативных фибробластах, но в -SMA – позитивных клетках эти структуры были контрастнее и толще.

Различное распределение белка ФК винкулина было отмечено в -SMA – позитивных и негативных фибробластах: в -SMA – позитивных клетках были выявлены длинные ФК под многочисленными выростами клеточного края; в -SMA

– негативных клетках чаще выявлялись точечные краевые контакты, более вытянутые ФК окрашивались в центральных частях клеток. Средняя длина ФК была больше у SMA – позитивных, чем у -SMA – негативных клеток. Количество контактов на клетку было, в среднем, меньше у -SMA – позитивных, чем у негативных клеток.

Организация клеточного фибронектина (ED-A FN) у -SMA – позитивных и -SMA – негативных клеток в популяциях фибробластов различного происхождения. В большей части -SMA – позитивных клеток были выявлены ED-A FN фибриллы, параллельные -SMA стресс-фибриллам, в -SMA – негативных клетках чаще всего не выявлялся ED-A FN. -SMA – позитивные и негативные варианты, содержащиеся в разных пропорциях в популяциях фибробластов, культивируемых из различных органов и тканей, обладали фенотипическими отличиями, предположительно связанными с различными функциями.

ЧАСТЬ 2. Динамическая молекулярная организация контактов клеткаэкстраклеточный матрикс при модуляциях экспрессии -SMA Роль -SMA изоформы в эволюции ФК Анализ разнообразия и характеристика категорий ФК.

Для изучения роли

-SMA на разных стадиях созревания ФК, а также анализа категорий ФК были использованы подкожные фибробласты человека в процессе миофибробластного перехода, который моделируется в культуре фибробластов с помощью TGF, -SMA

–позитивных клеток в контрольных условиях было не более 1-5%, а после 4 сут инкубации с TGF достигало 60-80%. -SMA – позитивные клетки принимали полигональную форму и занимали большие площади на субстрате, чем -SMA – негативные фибробласты из тех же или из контрольных культур. ФК были длиннее и толще у -SMA–позитивных, чем у SMA – негативных клеток. Данные морфометрии легочных фибробластов с высоким содержанием -SMA – позитивных клеток похожи на данные -SMA–позитивных фибробластов после инкубации с TGF. Выделено 3 категории ФК по значениям длины/площади: незрелые – площадь менее 2 мкм2, зрелые – 2-6 мкм2 и суперзрелые – более 6 мкм2. В контроле преобладали незрелые (60%) и зрелые (40%) ФК. После 5 сут с TGF практически исчезали незрелые ФК, оставалось 40% зрелых ФК и появлялось 55% суперзрелых ФК. Распределение ФК по размерам при инкубации с TGF в присутствии рекомбинантного фрагмента клеточного FN (rED-A) занимало промежуточное положение, количество суперзрелых ФК существенно уменьшалось. Структура незрелых, зрелых и суперзрелых ФК была проанализирована с помощью компьютерных программ 3D реконструкции LSM. Незрелые ФК были выявлены, в основном, в -SMA-негативных клетках в контроле и после 1-2 суток с TGF. Структуры (длиной 1,60 ± 0,45 мкм, шириной 0,78 ± 0,21 мкм) вблизи края и в центральной части ламеллы (Рис.1А), были часто связаны с -CYA-пучками. Эти винкулин- и паксиллин-позитивные ФК были колокализованы с 51интегрином (Рис.2A), тензин- и FAK- негативны. Пучки актина продолжали тонкие фибриллы ED-A FN на периферии клеток (Рис.3А).

Зрелые ФК были выявлены как в -SMA-позитивных клетках контрольных культур, так и в -SMA-позитивных клетках после 1-2 сут с TGF. Такие ФК были локализованы на нижней поверхности ламелл на расстоянии от края клетки, их средняя длина – 4,16 ± 2,43 мкм, ширина – 1,07 ± 0,46 мкм, связаны с -SMA– негативными или позитивными стресс-фибриллами. Данный тип ФК окрашивался на винкулин, паксиллин, тензин и FAK. Интегрин 51 был локализован на вентральной стороне винкулиновых контактов (Рис.

2А). Эти ФК были связаны с параллельными фибриллами ED-A FN на базальной поверхности клеток. Суперзрелые ФК обнаруживались в -SMA-позитивных клетках после 3-5 сут инкубации с TGF и в легочных фибробластах. Вытянутые цилиндрические, часто конические образования, в которых винкулин (Рис.1Б), паксиллин, тензин и FAK окружали концы -SMAпозитивных стресс-фибрилл. 3D реконструкция выявила 51-интегрин-позитивные слои параллельно цилиндрическим структурам винкулина (Рис.2Б, В). Средняя длина 16.07 ± 6.79, ширина 2.77 ± 1.48 мкм.

3D реконструкция выявила кисточко-подобные структуры ED-A FN фибрилл под нижней и над верхней поверхностями клетки, связанные с концами -SMAпозитивных пучков (Рис.3Б) и концами винкулин-содержащих ФК. ED-A FN фибриллы окружали 51структуры.

Биохимическая характеристика ФК-ассоциированных белков. Иммуноблоттинг для количественной оценки экспрессии паксиллина, винкулина и актина в цитоскелетной фракции фибробластов был проведен до и после 5 сут инкубации с TGF (максимальная экспрессия -SMA). Винкулин и паксиллин выявлены в цитозольной и цитоскелетной фракциях в контроле. TGF слегка повышал экспрессию винкулина и более значимо – паксиллина и актина. Включение этих белков в цитоскелетную фракцию увеличивалось при инкубации с TGF от 30% до 55% для винкулина, от 40% до 70% для паксиллина и от 50% до 80% для актина. В легочных фибробластах: включение в цитоскелетную фракцию винкулина около 40%, паксиллина - 90% и актина - 80%.

Действие rED-A на организацию FN сети и созревание ФК. При инкубации с TGF возрастала экспрессия ED-A FN и выявлялась система толстых параллельных FN-фибрилл, нарушаемая при добавлении rED-A в среду с TGF Выявление биотинилированного rED-A и FN показало, что rED-A колокализован с утолщенными лентообразными структурами FN. Добавление rED-A при инкубации с TGF блокировало экспрессию -SMA, приводило к дезориентации пучков актина (Рис.1В) и преобладанию незрелых и зрелых ФК, что означало rED-A-индуцированное ингибирование суперсозревания ФК (Рис.1В). При добавления rED-A на короткий срок обнаружено его преимущественное связывание с ФК (Рис.4А, Б).

Было проверено, может ли rED-A в бесклеточной системе декорировать FN матрикс, продуцируемый фибробластами. К DOC - нерастворимому матриксу добавили биотинилированный rED-A, который колокализовался с толстыми FN фибриллами. Эти результаты вместе с данными о том, что rED-A преимущественно связывается с FN в ФК, означали, что rED-A предпочтительнее встраивается в натянутые фибриллы FN. Для проверки этой гипотезы было исследовано, меняется ли встраивание rED-A в FN сеть после инкубации фибробластов с МЛ-7, ингибитором киназы легкой цепи миозина. rED-A встраивание было нарушено в клетках после инкубации с МЛ-7 по сравнению с контролем.

Рис.1. Изменение структуры ФК и стресс-фибрилл после инкубации фибробластов с TGF. Винкулин (красный) и (А) -CYA (зеленый) в контроле, незрелые (стрелка) и зрелые (головка стрелки) ФК; (Б) -SMA (зеленый), 5 сут с TGF; (В) -CYA (зеленый), 5 сут с TGF и rED-A. -SMA в стресс-фибриллах не выявлен. LSM. 3D-проекции, вид с базальной стороны клетки. Масштаб: 10 мкм.

Рис.2. Трехмерная структура винкулина и 51 интегрина в ФК. (А) Контроль:

незрелые (стрелка) и зрелые (головка стрелки) ФК; 51 (красный), винкулин (зеленый), колокализация (желтый). (Б, В) TGF, 5сут. (Б) 51 экранирует винкулин. (В) колокализация 51 и винкулина (желтый) в ФК (базальные срезы удалены). 3D LSM (вид с базальной стороны). Масштаб:10 мкм.

Рис.3. Организация ED-A FN и актина после инкубации с TGF. ED-A FN (зеленый) и (А) -CYA (красный) в контроле; (Б) -SMA (красный) после инкубации с TGF. LSM. 3D-проекции. Вид с базальной стороны. Масштаб: 10 мкм.

Рис. 4. Локализация биотинилированного фрагмента rED-A при встраивании в ED-A FN. HSCF 4 сут с TGF, затем 3 часа с 50 мкг/мл биотинилированного rED-A).

А: Биотинилированный rED-A (красный) встраивается (желтый) преимущественно в толстые фибриллы ED-A FN сети (зеленый); Б: винкулин (красный) в ФК частично колокализуются (желтый) с фибриллами rED-A (зеленый). LSM. Масштаб: 10 мкм.

Инкубация легочных миофибробластов с ингибиторами актомиозиновых взаимодействий BДM или MЛ-7 приводила к реорганизации системы стресс-фибрилл и исчезновению -SMA. Изменение длины ФК после инкубации с ингибиторами подтверждено морфометрически: средняя длина уменьшается в 3-6 раз (11,17 ± 0.75 мкм в контроле; 2.2 ± 0.25 мкм БДМ; 4.1 ± 0.21 мкм МЛ-7). ФК контрольных миофибробластов часто достигали 30 мкм. Распределение ФК по длине показало, что 60% ФК были более 8 мкм, после инкубации с ингибиторами контрактильности не оставалось ФК более 10 мкм, длина 75 % ФК была менее 5 мкм.

Суперсозревание ФК зависит от повышенной сократимости, связанной с экспрессией -SMA. При распластывании миофибробластов REF-52 формирование пучков -CYA предшествует встраиванию -SMA в стресс-фибриллы, что коррелирует с созреванием ФК и значительно повышает адгезивность фибробластов.

Ингибирование сократимости с помощью NH2-концевого декапептида -SMA (SMAFP) уменьшало адгезию миофибробластов до уровня -SMAнегативных клеток, а также приводило к диссоциации ФК. Для исследования динамики ФК и роли -SMA в их развитии с помощью видеомикроскопии, REF-52 с флуоресцентно-меченными маркерами ФК (3-интегрин), фибриллярных адгезий (5-интегрин) и паксиллином, сажали на эластичные субстраты с микро-рисунком, позволяющим наблюдать сократимость клетки и изменение интенсивности флуоресценции белков ФК под действием SMA-FP. Следующая динамика событий была выявлена после добавления SMA-FP: сначала уменьшалась сократимость суперзрелых ФК, затем снижались интенсивность флуоресценции паксиллина, плотности 3-интегрина и паксиллина.

Изменения 5-интегрина выявлено не было. Т.о., образование и стабильность суперзрелых ФК зависит от повышенной сократимости, определяемой -SMA (Hinz, Dugina et al, 2003).

Действие ингибиторов MEK1 и p38 на полимеризацию FN и экспрессию SMA. Влияние ингибиторов MAP-киназ на полимеризацию FN и экспрессию -SMA было проверено на TGF-дифференцированных миофибробластах. Ингибитор MEK1 не влиял на миофибробластную дифференцировку, индуцируемую TGF, тогда как преинкубация с ингибитором активации p38 блокировала полимеризацию ED-A FN и экспрессию -SMA.

Функция -SMA связана с модуляцией ФК при дифференцировке миофибробластов. Полученные результаты показали, что после инициации и созревания ФК подвергаются дальнейшей реорганизации, для обозначения которой мы предложили термин «суперсозревание». Обнаружено, что суперсозревание ФК, как постоянное свойство легочных фибробластов, либо индуцируемое TGF, соответствует появлению миофибробластных характеристик. Суперзрелые ФК всегда связаны с -SMA-позитивными стресс-фибриллами. При инкубации с TGF содержание винкулина, паксиллина и -SMA на клетку и размеры ФК увеличивались, а также увеличивалось включение винкулина, паксиллина и актина из цитоплазматической фракции во фракцию суперзрелых ФК.

Равновесие натяжения, определяемого актомиозиновым цитоскелетом, и устойчивостью внеклеточного матрикса в суперзрелых ФК. Ранее было показано (Bershadsky et al., 1996; Chrzanowska-Wodnicka, Burridge, 1996; Pletjushkina et al., 1998), что актомиозиновая сократимость клетки играет важную роль в преобразовании незрелых инициальных контактов в зрелые ФК. Подобным образом, увеличение цитоскелетного натяжения необходимо для сборки суперзрелых ФК.

Вероятно, механическая устойчивость FN сети клетки к натяжению необходима для суперсозревания ФК. В наших экспериментах ингибирование суперсозревания ФК было вызвано инкубацией с рекомбинантным фрагментом rED-A или редукцией актомиозиновой контрактильности. Таким образом, конечная стадия созревания ФК определяется равновесием натяжения актомиозина и устойчивостью ECM. Роль миофибробластов в продукции изометрического натяжения была показана как внутри грануляционной ткани in vivo, так и в условиях культивирования (Serini and Gabbiani, 1999). Это натяжение создает необходимое напряжение в месте ФК связующего звена между клеткой и ECM. При стимуляции TGF ФК приобретают морфологические и биохимические свойства, которые позволяют им лучше передавать натяжение от клетки к ECM и обратно.

ЧАСТЬ 3. Исследование организации и распределения - и -CYA в немышечных клетках Изучение внутриклеточной локализации - и -CYA в фибробластах и эпителиальных клетках при распластывании и в стабильном состоянии.

В первую очередь мы изучили организацию CYAs в процессе реорганизации актиновых систем клетки (Рис.5А-В; 7). При распластывании HSCF -CYA был распределен в виде кортикальной и ламеллярной сети; -CYA был локализован в кольцевых пучках и радиальных стресс-фибриллах в вентральной части клетки (Рис.5А). Эпителиальные клетки при распластывании имеют циркулярную морфологию с кольцевыми протрузиями, образованными -CYA сетями (Рис. 5В). CYA организован в филоподиальные (Рис.5Б) и кольцевые пучки (Рис.5В) в базальной части, тогда как -CYA-окрашивание выявлено в апикальной части клетки (Рис.5Вz). В культурах HSCF (3 сут) -CYA локализован в стресс-фибриллах близко к субстрату (Рис. 5Г), тогда как пучки в дорзальной части клетки состоят из -CYA (Рис. 5Гz). Подобным образом локализован -CYA в стресс-фибриллах фибробластов, трансфицированных -CYA-EGFP. -CYA-EGFP локализуется равномерно с повышением концентрации на ведущем крае. В стационарных фибробластах -CYA перераспределялся в стресс-фибриллы.

Эпителиальные клетки в культуре образуют островки с выраженными межклеточными контактами и генерируют базо-апикальную полярность;

протрузионная активность при этом сохраняется на краях, свободных от контактов с другими клетками. В этих условиях -CYA организован (Рис.5Д) в: 1) стрессфибриллы в базальной части клетки (с); 2) протяженные кольцевые пучки на периферии эпителиальных островков (с); и 3) тонкие короткие пучки в местах латеральных межклеточных контактов (b и Z-срез). -CYA локализован под апикальной мембраной (a и Z-срез) и в протрузиях вокруг островков (c). - и -CYA распределяются в специфических клеточных компартментах, базо-латеральном и апикальном, соответственно. Похожие результаты были получены на нескольких типах нормальных фибробластов, эпителиальных и эндотелиальных клеток, т.е.

обнаруженная сегрегация CYAs в разные компартменты и организация различных структур не являются уникальными для одного типа клеток.

Организация цитоплазматических актинов при миграции клеток.

Направленная миграция была индуцирована в культурах фибробластов и эпителиальных клеток в экспериментальной ране удалением части монослоя клеток.

Проанализированы пространственная организация CYAs и их участие в образовании тонких поляризованных протрузий на ведущем крае клетки. В обоих типах клеток протрузии были обогащены -CYA (Рис.6А, Б), а -CYA был организован в пучки в теле клетки ближе к субстрату (Рис. 6А, Б). Локализация -CYA в стресс-фибриллах наблюдалась и в фибробластах, трансфицированных -CYA-EGFP. -CYA-EGFP был равномерно распределен с концентрацией на ведущем крае поляризованной клетки.

При миграции и распластывании фибробластов дорзальный и ламеллиподиальный -CYA колокализован с кортикальным маркером спектрином и некоторыми изоформами тропомиозина. -CYA в ламеллиподиях колокализован с белками p34Arc и Arp3 комплекса Arp2/3. -CYA колокализован с миозином IIA в стресс-фибриллах и с VASP в ламеллиподиях и ФК.

Соотношение между сегрегацией актиновых изоформ и актомиозиновой сократимостью. Для изучения связи организации актинов и актомиозиновой сократимости мы, в первую очередь, проанализировали распределение изоформ в митотических клетках, т.к. ранее было известно, что малая ГТФаза RhoA контролирует определенные фазы митоза и концентрируется в местах повышенной сократимости: кортексе в метафазе, экваториальном районе анафазы и телофазном сократимом кольце (Piekny, Glotzer, 2008). В интерфазе и профазе митоза - и -CYA были распределены в базо-латеральный и апикальный домены клетки, соответственно. В метафазе -CYA перераспределяется в кортекс (Рис.7А), где колокализуется с -CYA. Далее, -CYA был сконцентрирован в экваториальном районе в анафазе (Рис. 7Б), сократимом кольце в телофазе (Рис. 7В) и при цитокинезе.

Повышенная концентрация -CYA в районе межклеточных контактов сохраняется в интерфазе. При распластывании HSCF в присутствии блеббистатина, ингибитора немышечного миозина II, наблюдалось исчезновение -CYA-содержащих стрессфибрилл и арок, а -CYA сеть была плотнее, чем в контроле.

Рис. 5. - и -CYA в различных клеточных структурах и компартментах. HSCF (А, Г), HaCaT (Б) и MDCK (В, Д) 3 час (А - В) или 3 сут (Г, Д) в культуре;-CYA (зеленый),-CYA (красный). Z-срезы – верхние изображения каждой панели.

Штриховые линии – уровень одиночных X/Y срезов (нижние изображения). -CYA в базальных стресс-фибриллах (А, Г, Дв), филоподиях (Б), межклеточных контактах (Дб) и кольцевых пучках микрофиламентов (A, В, Дв). -CYA в ламеллярных и дорзальных компартментах. Желтый - колокализация - и -CYA. LSM. Масштаб 10 мкм.



Pages:   || 2 | 3 |

Похожие работы:

«Потапова Анна Викторовна ВЛИЯНИЕ ЗАГРЯЗНЕНИЯ ТРОФИЧЕСКИХ СУБСТРАТОВ ТЯЖЁЛЫМИ МЕТАЛЛАМИ И ХЛОРОРГАНИЧЕСКИМИ СОЕДИНЕНИЯМИ НА КАЧЕСТВО ЛОСИНОГО МОЛОКА 03.02.08 – Экология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Москва 2015 Работа выполнена в ФГБОУ ВПО «Костромской государственный университет им. Н. А. Некрасова» Научный руководитель: доктор биологических наук, Баранов Александр Васильевич Официальные оппоненты: Марзанов Нурбий...»

«КЛОЧКОВ АНТОН СЕРГЕЕВИЧ РОБОТИЗИРОВАННЫЕ СИСТЕМЫ В ВОССТАНОВЛЕНИИ НАВЫКА ХОДЬБЫ У ПАЦИЕНТОВ, ПЕРЕНЕСШИХ ИНСУЛЬТ 14.01.11 – нервные болезни Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва 2012 Работа выполнена в Федеральном государственном бюджетном учреждении «Научный центр неврологии» Российской академии медицинских наук Научный руководитель: доктор медицинских наук, профессор Черникова Людмила Александровна Научный консультант: доктор...»

«ПОТОРОКО ИРИНА ЮРЬЕВНА НАУЧНОЕ ОБОСНОВАНИЕ И ПРАКТИЧЕСКИЕ АСПЕКТЫ ФОРМИРОВАНИЯ ПОТРЕБИТЕЛЬСКИХ СВОЙСТВ МОЛОЧНЫХ ПРОДУКТОВ, ПОЛУЧЕННЫХ ИЗ СЫРЬЯ НА ТЕРРИТОРИЯХ ТЕХНОГЕННОГО ЗАГРЯЗНЕНИЯ Специальность 05.18.15 – Технология и товароведение пищевых продуктов и функционального и специализированного назначения и общественного питания АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора технических наук Москва – 2012 Работа выполнена в ФГБОУ ВПО «Южно-Уральский государственный...»

«БААСТЫН ОЮУНГЭРЭЛ ЭКОЛОГО-ГЕОГРАФИЧЕСКИЕ ОСНОВЫ ФУНКЦИОНИРОВАНИЯ И ПЕРСПЕКТИВЫ РАЗВИТИЯ ОСОБО ОХРАНЯЕМЫХ ПРИРОДНЫХ ТЕРРИТОРИЙ СЕВЕРНОЙ МОНГОЛИИ Специальность: 25.00.36 – «Геоэкология (географические науки)» АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора географических наук Улан-Удэ, 2011 Работа выполнена в Институте Географии АН Монголии Научные консультанты: Член-корреспондент РАН, доктор географических наук, профессор Тулохонов Арнольд Кириллович Академик АНМ,...»

«КОСАРЕВА Ольга Сергеевна ИСХОДНЫЙ МАТЕРИАЛ ДЛЯ СЕЛЕКЦИИ НЕМАТОДОУСТОЙЧИВЫХ СОРТОВ КАРТОФЕЛЯ С КОМПЛЕКСОМ ХОЗЯЙСТВЕННО-ЦЕННЫХ ПРИЗНАКОВ Специальность: 06.01.05 – селекция и семеноводство сельскохозяйственных растений АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата сельскохозяйственных наук Санкт-Петербург Работа выполнена в отделе генетических ресурсов картофеля Всероссийского научно-исследовательского института растениеводства им. Н.И. Вавилова в 2005-2009 гг....»

«Бельский Евгений Анатольевич ЭКОЛОГИЯ ПТИЦ ИМПАКТНЫХ РЕГИОНОВ 03.00.16 – экология Автореферат диссертации на соискание ученой степени доктора биологических наук Екатеринбург 2010 Работа выполнена в Учреждении Российской академии наук Институте экологии растений и животных Уральского отделения РАН Научный консультант доктор биологических наук, профессор Безель Виктор Сергеевич Официальные оппоненты: доктор биологических наук, профессор Рябицев Вадим Константинович доктор...»

«НОВИЧКОВ Андрей Сергеевич МОЛОЧНАЯ ПРОДУКТИВНОСТЬ И КАЧЕСТВО МОЛОКА КОЗ РУССКОЙ ПОРОДЫ В УСЛОВИЯХ ТЕХНОГЕННОГО ЗАГРЯЗНЕНИЯ САРАТОВСКОЙ АГЛОМЕРАЦИИ 06.02.10 – частная зоотехния, технология производства продуктов животноводства АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Саратов – 2016 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего образования «Саратовский государственный аграрный университет им....»

«ОВЧИННИКОВ Андрей Никитич ДВУКРЫЛЫЕ СЕМЕЙСТВА SCATHOPHAGIDAE (DIPTERA) ЕВРОПЕЙСКОЙ ЧАСТИ РОССИИ: ВИДОВОЙ СОСТАВ, РАСПРОСТРАНЕНИЕ И МОРФОАДАПТИВНЫЕ ПРЕОБРАЗОВАНИЯ ЯЙЦЕКЛАДА Шифр и наименование специальности 03.02.05 – энтомология Автореферат диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург – 2013 Работа выполнена в Федеральном государственном бюджетном учреждении науки Зоологический институт Российской академии наук Научный руководитель:...»

«Монтеро Катчан Диана ЭКОЛОГИЧЕСКИЕ АСПЕКТЫ УСТОЙЧИВОГО РАЗВИТИЯ КОСТА-РИКИ специальность 03.02.08 — экология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва — 2013 Работа выполнена на кафедре экологического мониторинга и прогнозирования экологического факультета ГОУ ВПО «Российский университет дружбы народов» Научный руководитель: доктор химических наук, профессор, Зволинский Валентин Петрович заведующий лабораторией молекулярной...»

«Аверчева Ольга Владимировна Физиологические эффекты узкополосного красно-синего освещения растений (на примере китайской капусты Brassica chinensis L.) Специальность: 03.01.05 – Физиология и биохимия растений Автореферат диссертации на соискание учёной степени кандидата биологических наук Москва Работа выполнена на кафедре физиологии растений биологического факультета Московского...»

«ДУБОВСКИЙ ИВАН МИХАЙЛОВИЧ Эволюция резистентности вощинной огневки Galleria mellonella (L.) к энтомопатогенным бактериям и грибам 03.02.05 – энтомология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Новосибирск – 2015 Работа выполнена в Федеральном государственном бюджетном учреждении науки Институте систематики и экологии животных Сибирского отделения Российской академии наук в лаборатории патологии насекомых. доктор биологических наук,...»

«Порваткин Игорь Викторович ЛЕЧЕБНО-ПРОФИЛАКТИЧЕСКАЯ ЭФФЕКТИВНОСТЬ СПОРОГЕННЫХ ПРОБИОТИКОВ ПРИ ЖЕЛУДОЧНО-КИШЕЧНЫХ БОЛЕЗНЯХ ТЕЛЯТ 06.02.01 – диагностика болезней и терапия животных, патология, онкология и морфология животных АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата ветеринарных наук Саратов 2013 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования «Оренбургский государственный аграрный...»

«Калякин Евгений Александрович ПОЗДНЕМЕЛОВЫЕ МОРСКИЕ ЕЖИ СРЕДНЕГО И НИЖНЕГО ПОВОЛЖЬЯ: ТАКСОНОМИЧЕСКОЕ РАЗНООБРАЗИЕ, СТРАТИГРАФИЧЕСКОЕ ЗНАЧЕНИЕ Специальность: 25.00.02 – палеонтология и стратиграфия Автореферат диссертации на соискание ученой степени кандидата геолого-минералогических наук Саратов – 2015     Работа выполнена на кафедре исторической геологии и палеонтологии ФГБОУ ВПО «Саратовский государственный университет имени Н.Г. Чернышевского» Евгений Михайлович Первушов,...»

«ЯСАКОВА Ольга Николаевна ФИТОПЛАНКТОН СЕВЕРО-ВОСТОЧНОЙ ЧАСТИ ЧЕРНОГО МОРЯ 25.00.28 – океанология Автореферат диссертации на соискание ученой степени кандидата биологических наук Мурманск Работа выполнена в Южном Научном Центре РАН и Институте аридных зон ЮНЦ РАН Научный руководитель: Макаревич Павел Робертович доктор биологических наук, профессор Мурманский морской биологический институт КНЦ РАН Официальные оппоненты: Кренева Софья Викторовна доктор биологических наук,...»

«ЩЕПИТОВА НАТАЛЬЯ ЕВГЕНЬЕВНА БИОЛОГИЧЕСКИЕ СВОЙСТВА ФЕКАЛЬНЫХ ИЗОЛЯТОВ ЭНТЕРОКОККОВ, ВЫДЕЛЕННЫХ ОТ ЖИВОТНЫХ 06.02.02 – ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Уфа –2015 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования «Оренбургский государственный аграрный...»

«УДК 595.371.13(268.45) ИККО Наталья Викторовна ОСОБЕННОСТИ БИОЛОГИИ МАССОВЫХ ЛИТОРАЛЬНЫХ ГАММАРИД (CRUSTACEA: AMPHIPODA) В КОЛЬСКОМ ЗАЛИВЕ 25.00.28 – Океанология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Мурманск Работа выполнена на кафедре зоологии и экологии государственного образовательного учреждения высшего профессионального образования...»

«УДК 574.587 Барбашова Марина Александровна МАКРОБЕНТОС ЛАДОЖСКОГО ОЗЕРА И ЕГО ИЗМЕНЕНИЯ ПОД ВЛИЯНИЕМ ФАКТОРОВ СРЕДЫ 03.02.08 – экология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург Работа выполнена в лаборатории гидробиологии Федерального государственного бюджетного учреждения науки Институт озероведения Российской академии наук Научные руководители: Слепухина Татьяна Дмитриевна, доктор биологических наук Курашов Евгений...»

«Еремкина Татьяна Владимировна СТРУКТУРА И ФУНКЦИОНИРОВАНИЕ ФИТОПЛАНКТОНА ОЗЕР СЕВЕРНОЙ ЧАСТИ УВИЛЬДИНСКОЙ ЗОНЫ (Челябинская область) В УСЛОВИЯХ АНТРОПОГЕННОГО ЭВТРОФИРОВАНИЯ 03.02.08– экология (биология) Автореферат диссертации на соискание ученой степени кандидата биологических наук Борок 2010 Работа выполнена в Уральском филиале ФГУП «Госрыбцентр» Научноисследовательском институте водных биоресурсов и аквакультуры Научный руководитель: кандидат биологических наук Ярушина...»

«Фирстова Виктория Валерьевна Экспериментально-иммунологическое обоснование выбора стратегии оценки поствакцинального иммунитета против чумы и туляремии 14.03.09 Клиническая иммунология, аллергология АВТОРЕФЕРАТ диссертация на соискание ученой степени доктора биологических наук Оболенск 2015 Работа выполнена в ФБУН «Государственный научный центр прикладной микробиологии и биотехнологии» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека...»

«Абдуллаев Ренат Абдуллаевич ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ МЕСТНЫХ ФОРМ ЯЧМЕНЯ ИЗ ДАГЕСТАНА ПО АДАПТИВНО ВАЖНЫМ ПРИЗНАКАМ Шифр и наименование специальности 03.02.07 – генетика 06.01.05 – селекция и семеноводство сельскохозяйственных растений АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург Работа выполнена в Федеральном государственном бюджетном научном учреждении «Всероссийский научно-исследовательский институт растениеводства имени...»







 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.