WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 


Pages:     | 1 | 2 || 4 | 5 |

«ЗАЩИТА ЭКСПРЕССИИ ГЕТЕРОЛОГИЧНЫХ ГЕНОВ В ТРАНСГЕННЫХ РАСТЕНИЯХ ПОСРЕДСТВОМ ДНК-ПОСЛЕДОВАТЕЛЬНОСТЕЙ, ТЕРМИНИРУЮЩИХ ТРАНСКРИПЦИЮ. Диссертация на соискание ученой степени кандидата биологич ...»

-- [ Страница 3 ] --

4.1 Исследование возможности использования синтетических ДНК элементов, терминирующих транскрипцию Большую роль в процессах инактивации, в том числе и гетерологичных генов, играет репрессия на посттранскрипционном уровне (post-transcriptional gene silencing, PTGS). Механизм этого явления связан с тем, что при сосуществовании двух комплементарных молекул РНК, одна из которых может находиться в крайне малой концентрации, возможно возникновение двухцепочечной РНК, запускающей как деградацию самой дцРНК, так и индукцию репрессии гена, ответственного за синтез этой РНК.

Предполагается что явление PTGS, на данный момент более известное как РНК-сайлесинг или РНК-интерференция, это консервативный эукариотический механизм растительного мониторинга вирусных частиц, защищающий геном от транспозонов и участвующий в регуляции экспрессии генов. Для преодоления вышеописанных проблем, используют такие методы, как встраивание в экспрессионную кассету, наряду с гетерологичным геном, вспомогательных регуляторных элементов, способствующих увеличению уровня экспрессии и снижению её вариабельности. Такими факторами являются некоторые элементы генома, которые можно условно подразделить на три класса. Это инсуляторы, LCR-элементы (локус контролирующие регионы) и MAR-элементы (последовательности, связывающиеся с матриксом). В некоторых случаях к ним причисляют и определенные виды терминаторных последовательностей, обладающих определенной структурой, характерной для растительной ДНК.

Кроме непосредственно терминирующей части, присутствующей и в вирусных терминаторах, и сайта полиаденилирования у таких элементов присутствует ряд других повторяющихся блоков, что способствует наиболее полному и эффективному высвобождению молекулы РНК и дальнейшему участию в процессе трансляции. Исходя из этого, создание регуляторных элементов терминирующих транскрипцию для повышения эффективности экспрессии чужеродных генов в растениях выглядит весьма многообещающе. В то же время репрессионные эффекты при встройке гетерологичного гена могут быть связаны и с транскрипцией, проходящей через сам гетерологичный ген. Инсуляторы и активаторные регуляторные элементы не способны останавливать такую транскрипцию. Таким образом, использование терминаторов транскрипции в экспрессионных векторах должно помочь в защите гетерологичного гена от негативных транскрипционных эффектов генома. Для настоящих исследований, в целях регуляции экспрессии и получения высокого и стабильного уровня выхода целевого белка, было решено в качестве регуляторных, использовать терминаторные последовательности, обрывающие геномные траснкрипты в местах встройки гетерологичного гена.

В первой части работы мы проводили исследования по влиянию на экспрессию гетерологичных генов двух новых искусственных регуляторных элементов, условно названных «элемент I» и «элемент II». В одной из последовательностей (элемент-I) терминатор гена NOS (247 пн) был окружен с одной стороны искусственно созданным в нашей лаборатории рибозимом (52 пн), с другой - рибозимом из бета глобинового гена (226 пн) (Teixeira et al., 2004).

Рибозим – это последовательность РНК с собственной ферментативной активностью, стимулирующей разрывы в РНК. Для рибозима из бета-глобинового гена была показано ключевая роль в усилении терминации транскрипции (Teixeira et al., 2004). Во втором ДНК-фрагменте (элемент-II) вышеописанными рибозимами был окружен вирусный сигнал полиаденилирования гена CaMV 35S (210 п.н.). Таким образом, оба ДНК-фрагмента должны быть эффективными терминаторами транскрипции в растениях.

В нашей лаборатории было сконструировано по два вектора для каждого исследуемого элемента, т.е. в целом были собраны пять конструкций (рис.1). В качестве репортерного гена для дальнейшего анализа показателей уровня экспрессии было решено взять ген -глюкуронидазы (GUS). Конструкции собирались на основе вектора pBI121 (Jefferson et al., 1987), в котором Т-ДНК несет ген GUS под контролем 35S CaMV промотора и терминатора нопалинсинтетазного гена nos, а также ген неомицинфосфотрансферазы nptII в качестве селективного маркера (Jefferson et al., 1987). Вектор pBIGeI содержал регуляторный элемент I с одной стороны от экпрессионной кассеты, в pBIGeI-I фланкировал ее с обеих сторон. Вектора pBIGeII и pBIGeII-II имели регуляторный элемент II в таких же позициях. В качестве контроля была взята плазмида pBIG с репортерным геном uidA не содержащая дополнительных регуляторных элементов.

Рисунок 1. Схематичное изображение использованных в работе конструкций.

Промоторы показаны в виде стрелок. 35S - 35S CaMV, промотор вируса мозаики цветной капусты; GUS – ген белка -глюкуронидазы; Tnos – терминатор нопалин синтазы; Pnos- промотор нопалин синтазы; nptII- ген устойчивости к канамицину; LB, RB

-последовательности левой и правой границ Т-ДНК;

4.1.1 Генетическая трансформация растений

Полученные плазмиды были перенесены в супервирулентный агробактериальный штамм CBE21, сконструированный на основе дикого штамма A. tumefaciens А281 с Ti-плазмидой pTiBo542. Впоследствии полученные вектора были использованы для проведения трансформации листовых эксплантов табака.

Регенеранты отбирались на селективной среде с канамицином в концентрации 50 мг/л. Каждое растение, полученное в результате единичного трансформационного события и устойчивое к селективному антибиотику, было впоследствии вегетативно размножено на шесть клонов. Каждое растение, полученное в результате единичного трансформационного события и устойчивое к селективному антибиотику, было впоследствии вегетативно размножено на шесть клонов. После проведения трансформации, клонального микроразмножения полученных растений до требуемого числа и укоренения, производился дальнейший их перевод в условия закрытого грунта. В результате в теплицу было перенесено по шесть растений каждой линии.

Для всех полученных линий каждой из пяти плазмид был проведен анализ выделенной тотальной ДНК. Для экстракции геномной ДНК использовался растительный материал in vivo. С тепличных растений срезался третий лист побега. Выделение проводилось по модифицированному нами протоколу. Все полученные линии были проверены на отсутствие вирусной контаминации, проверкой наличия генов вирулентности (virA/virB, 670 пн), и на вставку селективного маркера (nptII, 742 пн), присутствие которого позволяет предварительно сделать вывод о наличии используемой конструкции в геноме исследуемого растения. В линиях свободных от агробактерий и содержащих, по результатам ПЦР, ген неомицинфосфотрансферазы, методом ПЦР проверялось непосредственно наличие репортерного гена и анализируемых нами последовательностей. В связи с тем, что в некоторых конструкциях один и тот же элемент присутствовал в двух различных положениях, анализ таких растений проводился с использованием двух пар праймеров. Проверка проводилась с помощью следующих комбинаций:

1tob2 Mar 2-1 и Mar 2-2 (715 пн) 1tob3 Mar 3-1 и Mar 3-2 (597 пн) 2tob2 Mar 2-1 и nptII-F (2663 пн) Mar 2-2 и CaMV35S-R (922 пн) 2tob3 Mar 3-1 и nptII-F (2551 пн) Mar 3-2 и CaMV35S-R (803 пн) Для определения наличия гена белка GUS использовались стандартные праймеры GUSA1 и GUSA2. Линии, не содержащие одной из последовательностей, были изъяты из эксперимента. Так же наблюдались некоторые потери при поддержании растений in vitrо, в основном за счет бактериального и грибкового заражений.

Каждая из оставшихся линий гистохимически проверялась на наличие экспрессии гена GUS путем анализа его активости при использовании реактива XGLUC. Все образцы, не показавшие наличие окраски, а, следовательно, и экспрессии гена GUS, так же не были использованы для дальнейших экспериментов. В результате, для последующих анализов осталось 29 линий (174 растения), см. табл. 1.

Таблица 1. Результаты трансформации листовых эксплантов табака.

aКонструкции представлены на Рис.1

–  –  –

4.1.2 Анализ уровня экспрессии репортерных генов На следующем этапе измерение активности гена проводилось флюориметрически, что позволило количественно определить уровень экспрессии репортерного гена. Для этого был получен белковый экстракт каждого из растений плюс отрицательный контроль (нетрансгенное растение табака). Экстракция тотального белка растений проводилась с использованием буфера 1. Измерение проводилось при использовании реактива 4-MUG (4метилумбеллиферилглюкоронида), который при расщеплении -глюкуронидазой до 4-MU имеет оптимумы возбуждения при 365 нм и излучения при 455 нм.

Количество репортерного белка оценивалось относительно общего белка экстракта, определение концентрации которого проводилось по реакции Бредфорд. Окончательные концентрации были получены в следующей размерности: нмоль 4-MU/ ч на г общего белка.

Таблица 2. Активность GUS в трансгенных растениях табака.

a Конструкции представлены на Рис.1 b Средняя активность GUS в нмоль 4- MU ·мин-1·мг общего растворимого белка-1

–  –  –

Рисунок 2. Активность GUS в мкмоль 4-метил-умбеллиферона в мин на мг общего белка с ± стандартной ошибкой всех измерений в каждой популяции.

Статистически достоверные отличия между группами и контролем отмечены одной звездочкой (p0,05) или двумя (p0,1).

Полученные результаты (рис.2, табл.2) демонстрируют, что присутствие в конструкции тестируемых элементов, способных путем обрыва транскриптов изолировать конструкцию от геномных сигналов, приводит к увеличению уровня экспрессии репортерного гена GUS (в два с половиной раза для pBIGeI и в шесть раз для pBIGeII по сравнению с контролем) при их расположении с одной стороны

– выше по ходу транскрипции. При расположении регуляторных элементов по обе стороны экспрессионной кассеты уровень экспрессии наоборот снижается. При этом можно видеть, что и первый и второй эффекты сильнее выражены при использовании элемента-II. Вероятно, это связано с тем, что второй элемент дублирует присутствующий в конструкции nos терминатор, который находится на конце гена неомицинфосфотрансферазы nptII (рис.1). В тоже время дупликация последовательностей в конструкции может приводить к повышению частоты перестроек и снижению эффективности экспрессии.

Однако ни один из данных элементов не оказывает положительного влияния на уменьшение вариабельности экспрессии. Можно предположить, что разброс экспрессии, запускаемой с 35S-промотора, зависит от транскрипционной активности хроматина в месте интеграции гетерологичного гена. Тестируемые элементы, которые прерывают транскрипцию, не могут защитить промотор от негативного/позитивного влияния окружающих геномных регуляторных факторов. С другой стороны, элементы, терминирующие транскрипцию, прерывают синтез РНК, который инициируется в окружающих гетерологичный ген последовательностях. Таким образом, происходит частичная супрессия эффекта РНК-интерференции, что приводит к увеличению экспрессии гетерологичного гена. Большинство других регуляторных элементов, используемых для увеличения экспрессии гетерологичного гена, непосредственно влияют на уровень транскрипции: сильные промоторы, А/Т-богатые ДНКпоследовательности, связывающие белки ядерного матрикса и др. Так как терминаторы транскрипции имеют отличный механизм действия, то они могут быть эффективно использованы совместно с другими регуляторными элементами для синергетического усиления экспрессии репортерных генов в трансгенных растениях. Это позволяет отметить данные элементы как возможные компоненты для создания экспрессионных кассет, направленных на получение высоких и стабильных уровней экспрессии целевого гена в различных растительных объектах. Вероятно, данные элементы могут быть использованы в создании трансгенных растений практически для всех отраслей их применения, таких, например, как биотехнология и сельскохозяйственное производство. Однако понятно, что для дальнейшего использования синтезированных элементов, как в научно-исследовательских целях, так и для разработки сельскохозяйственноценных культур, необходим более подробный и надежный анализ их действия, который позволил бы точно оценить влияние этих последовательностей на трансгенную экспрессию и давал бы возможность предсказать их поведение в других растительных организмах, полученных, возможно, при использовании других экспрессионных кассет.

4.2 Исследование возможности использования растительных ДНК элементов, терминирующих транскрипцию 4.

2.1 Поиск регуляторных элементов В настоящее время для достижения высоких уровней наработки целевых белков в трансгенных растениях используются, в основном, сильные регуляторные элементы вирусного происхождения. В первой части эксперимента мы изучали влияние фрагментов терминаторов генов NOS и CaMV 35S, определенным образом совмещенные с рибозимами, на экспрессию гетерологичных генов в растениях табака. Однако, не смотря на то, что применение этих последовательностей показало себя достаточно эффективным, в целом, использование как вирусных, так и бактериальных элементов может привести к негативным последствиям. Часто такое влияние негативным образом сказывается на метаболизме растения и его фенотипе, что, отчасти, и было замечено нами в предыдущем эксперименте. Кроме того, использование трансгенных растений с чужеродными последовательностями бактериального или вирусного происхождения в сельскохозяйственном производстве встречает настороженное отношение потребителей к продуктам, содержащим фрагменты генома пусть и растительных, но патогенных организмов, несмотря на многократно доказанную их безвредность для человека. Использование регуляторных элементов растительного происхождения и создания цисгенных растений, может стать решением этих проблем. В связи с этим целью дальнейшей работа было создание растений именно с такими регуляторными элементами и исследование их свойств.

В связи с тем, что предыдущие наши исследования показали достаточный уровень влияния терминаторных последовательностей, в дальнейшем предполагалось использовать элементы с такой же функцией. Однако в настоящий момент, не известно структуры даже более-менее подробно описанных и изученных растительных терминаторных последовательностей, обеспечивающих значимое влияние на уровни экспрессии в растениях, да и в принципе растительных терминаторов. Таким образом, первым нашим шагом в достижении поставленной задачи был поиск терминаторных последовательностей в растительном геноме. Для решения подобной задачи можно полагаться не только на сами последовательности, отвечающие за терминацию транскрипции, но ориентироваться также и на сайты полиаденилирования, которые присутствуют в непосредственной близости от них. Наличие этих признаков должно указывать на сильные терминаторные способности сайта. Однако, на данный момент, в литературе нет полного и обобщенного описания даже самих сайтов терминации транскрипции у растений, их структуры и механизмов функционирования. По большей части, это связано с тем, что и особенности процесса терминации транскрипции в растительных клетках на данный момент практически не изучены. Опубликованные в этом направлении исследования фрагментарны, и не представляется возможным создать полную картину структуры таких элементов и особенностей их функционирования в растительных объектах. Эти работы, в большинстве случаев, представляют собой описания конкретных сайтов терминации у отдельно взятых растительных генов. Однако и такие описания зачастую бывают достаточно подробными, более того, в некоторых работах представлены типичные, предположительно консервативные, последовательности вблизи сайтов терминации, по которым возможна идентифицикация в геноме.

Рисунок 3. Возможные сайты терминации ранскрипции Lhcb1*6.

(Hasegawa et al., 2003). 3-фланкирующая область гена Lhcb1*6. Стоп-кодон и предполагаемый поли(А) сигнал обведены рамкой, поли(А) сайт отделен чертой. Примерные 3-концы транскриптов выделены (T1–4).

Обнаружение таких консервативных терминирующих последовательностей существенно затруднено так же и в связи с тем, что эукариотические мРНК накапливаются в виде полиаденилированных форм in vivo, а понимание процессов формирования 3-конца мРНК в растениях весьма смутно. Тем не менее и эту проблему удается преодолеть. Например, в работе 2003 года (Hasegawa et al., 2003), для исследования регуляторных последовательностей была использована система in vitro без детектирующейся полиаденилирующей активности, что, с практической точки зрения, позволило обнаружить 3- концы пре-мРНК.

Были идентифицированы сайты поли(А) в in vivo транскриптах lhcb1 гена (рис. 3). У млекопитающих и дрожжей высококонсервативный поли(А) сигнал, шестинуклеотидная последовательность AAUAAA, в большинстве случаев задает поли(А) сайт через 10-30 нуклеотидов (Zhao et al., 1999). Эта последовательность известна в растениях так же как ближний элемента против хода транскрипции (NUE-near upstream element). В случае дрожжей поли(А) сигнал играет важную роль в контроле и инициации и терминации транскрипции полимеразой II (Minvielle-Sebastia and Keller, 1999). Несмотря на то, что последовательности содержащие поли(А) сигнал в растительных мРНК менее консервативны, AAUAAA или AAUAAA-подобные последовательности часто обнаруживаются в концевой части растительных мРНК (Mogen et al., 1992; Wu et al., 1993, 1995).

Однако это верно не для всех случаев. Например в петунии AAТAAA – подобных последовательностей обнаружено не было (Dunsmuir et al., 1985), так же, как и в случае гена lhcb1*9 в Nicotiana sylvestris (Hasegawa et al., 2003). Более того стандартная последовательность NUE AATAAA находится в консервативной позиции лишь у 10% генов арабидопсиса (Loke et al., 2005), тогда как для человеческого генома это верно для половины генов (Hu et al., 2005). Если посмотреть на геном млекопитающих - у них за поли(А) сигналом располагается дополнительный цис-элемент, который как правило состоит из T/TG-богатых последовательностей. Такие FUE-последовательности (far upstream elements) представляются так же важными элементами функционирования поли(А) сигнала (Zhao et al., 1999). В растительных мРНК выше поли(А) сигнала были найдены похожие последовательности, но большей длины и менее консервативные (Rothnie, 1996; Wu et al., 1995). Было показано, что NUEs и FUEs в геноме Arabidopsis thaliana могут иметь более чем 50 вариантов (Loke et al., 2005).

Поли(А) сайт был идентифицирован in vivo и в шести генах LHCB1 N. sylvestris.

На 12-21 нуклеотидов выше поли(А) сайта присутствуют AAТAAA – подобные последовательности. Кроме того, выше предполагаемого поли(А) сигнала были обнаружены и FUE GT-богатые последовательности, которые, возможно, так же играют важную роль в полиаденилировании (Hasegawa et al., 2003) и по которым, соответственно, такие сайты можно идентифицировать. Исходя из этого, подобные сайты использовались в нашем поиске, для подтверждения терминирующих свойств последовательностей и такие группы были обнаружены после некоторых генов в арабидопсисе. При использовании метода защиты от РНКаз были детерминированы 3- концы in vitro транскриптов гена lhcb1*6 (Hasegawa et al., 2003). При электрофоретическом разделении среди нескольких обнаруженных продуктов, был и соответствующий поли(А) сайту из растений in vivo. Кроме вышеупомянутого поли(А)-продукта в использованной системе наблюдалось еще четыре значительных полосы соответствующих продуктам большей длины. Эти полосы воспроизводимо обнаруживались в череде экспериментов и так же были замечены при использовании конструкций с укороченным кодирующим регионом. Эти результаты напрямую говорят о том, что терминация транскрипции у lhcb1*6 происходит в нескольких определенных сайтах. Эти сайты расположены внутри или поблизости от Т-богатых регионов. В клетках млекопитающих было однозначно показано, что PolII-зависимые гены имеют специфические G-богатые регионы, расположенные после поли(А) сигнала, которые вызывают паузы в транскрипции, что в результате ведет к активации полиаденилирования in vitro (Yonaha and Proudfoot, 1999). Однако никаких подобных G-богатых последовательностей не было обнаружено в области, соответствующей 3-концу транскрипта lhcb1*6, и, таким образом, эти результаты свидетельствовали о различии в процессе терминации транскрипции растений и таковых в клетках млекопитающих. Детектировалось и несколько полос продуктов меньших по размеру чем соответствующие поли(А) сайты.

В настоящее время объяснения появления этих коротких транскриптов так и не нашли, несмотря на то, что некоторые из них присутствуют и при транскрипции in vivo. Не исключена и частичная деградация продукта. У животных расстояние от поли(А) сайта до места терминации транкрипции варьирует (от нескольких сотен до нескольких тысяч нуклеотидов), тогда как большинство транскриптов lhcb1*6 терминируются в регионе приблизительно трехста нуклеотидами ниже поли(А) сайта. По этой причине сигнал терминации lhcb1*6 представляется более эффективным, чем подобные последовательности в клетках животных, предотвращая воздействие нижележащих промоторов и, так же, сберегая энергию, сокращая лишнюю транскрипцию с последующих регионов. В целом, последовательности из четырех и более Т-остатков в 3-области уже считаются эффективными терминаторами (Allison & Hall 1985; Lin-Marq & Clarkson 1998;

Platt 1986). При нашем анализе для подтверждения терминирующих функций во внимание принимались как известные NUE и FUE, установленные в описанных работах, так и другие последовательности, упомянутые выше. Обнаружение сразу нескольких последовательностей было значительным стимулом для выбора конкретных участков генома.

В качестве донора регуляторных элементов был рассмотрен ряд растений, из которых в результате было выбрано модельное растение Arabidopsis thaliana.

Это объясняется тем, что это растение не только хорошо изучено, и используется как модельное наряду с табаком, Nicotiana tabacum, но и является первым растением, для которого было проведено полногеномное сиквенирование.

Благодаря этому, для растений арабидопсиса возможен поиск регуляторных единиц по всему геному. Мы использовали электронную базу, содержащую полногеномный сиквенс арабидопсиса The Arabidopsis Information Resource (TAIR) http://www.arabidopsis.org -информационный ресурс по арабидопсису содержащий базу данных генетических и молекулярно-биологических данных модельного растения Arabidopsis thaliana. Информация имеющаяся в этой базе содержит полногеномный сиквенс наряду со структурой генов, сведениями о продуктах работы гена, метаболизме, экспрессии генов, геномными картами, генетических и физических маркеров, а также публикациями. Поиск терминаторных последовательностей в этой базе проводился с помощью специально созданной программы (созд. Тихонов М. В.), основанной на методах математического моделирования, которая отбирала участки, отвечающие определенным требованиям. Мы выбирали участки генома между двумя генами, рамки считывания которых направлены друг на друга, а экспрессия с этих генов идет во всех органах растения и на всех стадиях развития. В результате чего, с высокой долей вероятности можно предполагать, что между этими генами находятся сильные сайты терминации. Так же нас ограничивал размер участков, т.к. последовательности большой длины не выгодно использовать при создании конструкций, что сопряжено с рядом трудностей при ее переносе в растительный геном. Таким образом, из общей массы геномных последовательностей нами было выбрано шесть, предположительно регуляторных элементов, отвечающих за терминацию транскрипции. При ближайшем рассмотрении, основываясь на более подробном изучении наличия и структуры различных последовательностей нуклеотидов и их повторов, особенности которых описаны выше, из этих шести элементов было выбрано три, наиболее полно отвечающих параметрам терминаторов транскрипции (рис. 4).

• AT I – последовательность между генами субъединицы коатомера гамма-2 (локус AT4G34450) и гуанин нуклеотид-связывающего белка AGB1 (локус AT4G34460).

• AT II – последовательность между генами белка цикла клеточного деления CDC48 (локус AT3G09840) и белка содержащего D111/G-patch домен (локус AT3G09850).

• AT I-IV – последовательность между генами 60S субъединицы рибосомного белка P2 (RPP2D) (локус AT3G44590) и циклофилина 71 (локусAT3G44600).

–  –  –

GTTGACCCAAGCACAGGTGAAGCAGAAGATGATGGAGTAGAAGATGAGTACCAGC

TAGAGGATCTTGAGGTTGTAGCTGGAGATTACATGGTGAAAGTGGGTGTCTCCAATTTCAG

GAATGCGTGGGAAAGCATGGATGAAGAAGATGAGCGTGTAGACGAATATGGCCTTGGCCA

AAGAGAGAGTTTGGGAGAAGCTGTAAAGGCTGTCATGGATCTTCTTGGCATGCAGACTTGT

GAGgttagtctcttccacttttttctcatactctactgagacttgagggctaaaattattgttgataaagtcttttttgagtatatgaccatttgttgtgtt cctgaaattgaaactgacactggataaataacagGGGACGGAGACAATTCCGCTCAATGCAAGGTCACACAC

GTGTCTATTGTCAGGTGTGTACATAGGCAACGTGAAAGTGTTAGTGAGGGCACAGTTTGGA

ATGGACAGCTCAAAGGACATTGCAATGAAGCTGACAGTTAGAGCTGAAGACGTTTCTGTC

GCCGAGGCCATTCACGAGATTGTTGCCAGCGGCTAAaacctcttgcgtttcttcagtatcagagaatgtcatctattcc tgctgctaaacctcaaaaatacatcaactattataaatagcatagtattactttctttcttttttccttgcattattactgtcaaatacactatggaggttttcttttt attttatgacggtgctttttgatttctcatttctgaattttattattacccgttttctcgccaagttgggaatctacagatcatcttgctcggatttgaaaaccact accgtaccgtacaacaggctaggctttctccataagttagaaactcaaaaatagtagcgttttatcgtctgcgttcaatatgaagagatgatagtaaagta aagactggtgggtacacaattgattacagaattcacattgagtagcgtgttgaaggagtttagttcccaatgaagaaataaataaatcaaagcacacta caaaaagggaagtttaattcttctaaccactccactatttcaaaccaaacaccttccacaaaccgaaccttacttcccgactacagaatatattaaccaac aactggagacgtgactcctactttcgttaaatcttctTCAAATCACTCTCCTGTGTCCTCCAAACGCCCATATctgtgtg aattcaacgaaatttcatctatcctctaatttccttacaaacataacatggtaaatgataagcagagacactactaagtactaacCTTTAGAT

TTGAATCCCAACTTCCTGTACACAAGGCACTTCCATCTGCTGACAACCCCAAACAGCTTATT

CTATTCCTGTGTGAATCCTGCTGTAATCCCAAATCCAATACAAC

ATII 1400 bp

CCTGACATTATCGATTCAGCTCTTCTCCGTCCTGGAAGGCTTGACCAGCTCATTTACA

TTCCACTACCAGATGAGGATTCCCGTCTCAATATCTTCAAGGCCGCCTTGAGGAAATCTCCT

ATTGCTAAAGATGTAGACATCGGTGCACTTGCTAAATACACTCAGGGTTTCAGTGGTGCTGA

TATCACTGAGATTTGCCAGAGAGCTTGCAAGTACGCCATCAGAGAAAACATTGAGAAGgtta

gagatcccatcgccaagctctttatccaaagattgttatactctccaatcgttgaactgaagctcatgttttttttttgtttcagGACATTGAAA

AGGAGAAGAGGAGGAGCGAGAACCCAGAGGCAATGGAGGAAGATGGAGTGGATGAAGTA

TCAGAGATCAAAGCTGCACACTTTGAGGAGTCGATGAAGTATGCGCGTAGGAGTGTGAGT

GATGCAGACATCAGGAAGTACCAAGCCTTTGCTCAGACGTTGCAGCAGTCTAGAGGGTTC

GGTTCTGAGTTCAGGTTCGAGAATTCTGCTGGTTCAGGTGCCACCACTGGAGTCGCAGATC

CGTTTGCCACGTCTGCAGCCGCTGCTGGGGACGATGATGATCTCTACAATTAGtgataacttctttatc ctttttttttttaagttttaaaactcgaattctctacttttggattactggggaaagtgatactgattctttcctcgtgtttttaagttatccgaatctcttgtgtttgg gttttaatcaatgttcttaattttcgtttcaatacttgtttggtcgttcattacaaatggaaaaaataaaggattataaagtaagttaaaaagattgcaagtgat aagtaattgctttataagtggtaagtatcacaaatgttcccacttatcagcaatttccgcatatcaatgttaatgctctaagatcggtactttcttttatagaat cttggagccgaggatgtatttttttttgcatcaatggtggttaaagaagccaaaagaaaggatgctttattatgtcaacaacattgatgtcaagataacaa caaagctgctcccaagtcttaaacataaattgaacaaaggccacatgttgaagattgaagatgaacatacttaaaaacgatatcttactgttcttgttcaa acattgaccgttaaatacttcaatgtTTAGCCTTCAGCACCTATTCCACGTGCTCTAGGACGTCTGACAGCG

ACCAGCGGATTGACTATGCCTTGTGACTCTCTACCCAGACCCGAGCCTTCGACGAAACCCA

TTCTCGCCATCATCCTCGACCCAAAGCCTGTTGTGTGCTGCTCAAAGGCTCCCAATCTTTTG

TCCCTGATTCTTCCTGAACCAGAGGCACCATTGTC

ATIV 1051 bp

GTCTGTGCCATCTGGTGGTGGTGTGGCTGTTTCAGCTGCTCCATCAAGCGGTGGTGG

TGGTGCTGCTGCCCCTGCGGAGAAGAAAGAAGCCAAGAAGGAAGAGAAAGAAGAGTCTG

ATGATgtaaagcatttctctctttatcattttgtttccttattacttagtctttgttatggtcttgatattggtctttatctgactctttgttatatccttcacctt tgatgcagGACATGGGATTCAGTCTCTTCGAGTAAggtttttgtccccacggaaaggagtcgagatttgattttttgttctctta gtggttctggtttttgcttcttggattacgaattttactccttagataatgaagcaagaagagttttttcaactatgttgcgaccttgcgggttattcatttatcgt tttccgtttgatttacatgttgaatctggtctaagcttgtaatttacatagtttagttcatagtatgttagcatatcacaaaataagtgcctaagagggctagaa tttgatacactcatggaaaagtttatctttagtgatcccaaataaacagaaaaatccaaatccaagtgaaattgagattctatgttattaacttcaaacattg gtgttgtcgtgttgtcgtttcagacataaacccatgaagcttggataaattagaagaaagtagatcaactctatttcaagaaaataagaggaattgaagta acattagaagttgaagtctttttgttcactaagcattctcataaaatttgtttgacaaaaacataaaataatgtttagtgtcaagaagatgatgccaccaactt aacctgatctgctcgggtacaacaaacatatcccacagttcgatccatctccgcaagaacaacttcccagcatagaaccaatcacggggttacggatc agcatagattgttcactatctttgagacagtagcaaagatgCTAAGATTTCGGAACGGTGACATTAAGTATCTTCACA

TCTTGGTAAGGCCTGTCGTTCTTGTCTGTCTTCACTTTCTCTATACC

Рисунок 4. Терминаторные последовательности ATGC-экзон; atgc-интрон; TAA- стоп кодон; atgc – AATAAA NUE DIR; atgc – AATAAA NUE REV; atgc – потенциальное NUE DIR; atgc – потенциальное NUE REV; atgc- FUE DIR; atgc-FUE REV В дальнейшем выбранные нами регуляторные элементы, были клонированы из генома выбранного нами растения Arabidopsis thaliana. Семена арабидопсиса предоставлены А.Ю. Скрипниковым (МГУ, биофак). Растения арабидопсиса были пророщены из семян, и тотальная ДНК из них выделялась по стандартной методике. Получение последовательностей проводилось с использованием специально разработанных нами двух пар праймеров для каждого из ДНК элемнтов, терминирующих транскрипцию. Причем одна из пар праймеров являлась комплементарной участкам цепи генома арабидопсиса, располагающимся в более дистальной позиции, чем участки, комплементарные второй паре. Таким образом, сначала происходил синтез более длинного участка цепи с upstream праймеров, который подвергался последующему выделению и очистке и лишь потом с использованием его как матрицы, происходил синтез непосредственно того участка, содержащего интересующий нас регуляторный элемент, который использовался нами в дальнейшей работе.

Для анализа влияния полученных элементов на уровень экспрессии генов в растениях, эти последовательности были сгруппированы нами в два кластера, один из которых впоследствии имел расположение справа от экспрессионной кассеты, а второй, соответственно, слева от неё. В качестве репортерных генов для последующей оценки показателей уровня экспрессии снова был взят ген глюкуронидазы GUS, а также ген зеленого флуоресцентного белка GFP. В создаваемых экспрессионных векторах оба репортерных гена были помещены под промоторы разной силы и природы (вирусной, бактериальной или растительной), что в дальнейшем позволило произвести более полный и многосторонний анализ изменения экспрессии, при использовании регуляторных элементов.

Использовались два промотора вирусного происхождения, наиболее часто используемых при трансформации растений, и два более редких растительных промотора.

• 35S CaMV - промотор вируса мозаики цветной капусты • 35Smin - минимальная активная единица CaMV 35S промотора, представляющая собой 57-нуклеотидный фрагмент (от -49 до +8)

• RuBisCO - сильный растительный промотор малой субъединицы рибулозо-1,5-бисфосфат карбоксилазы томата (RuBisCO) c 250 нуклеотидным интроном, представляющим собой комбинацию 5'UTR последовательности гена фосфоенолпируват карбоксилазы томата (сорт Ялф) и энхансера (синтетического двойного энхансера ocs агробактериального промотора гена октопин синтазы)

• ELIP - уникальный укороченный по HindIII сайту промотор белка светового стресса ELIP (Bruno & Wetzel, 2004) Без сомнения именно 35S промотор вируса мозаики цветной капусты на данный момент является наиболее изученным и широко используемым при трансформации растений, как в исследовательских целях, так и для коммерческого применения. Вирус мозаики цветной капусты (CaMV) является параретровирусом поражающим семейство Brassicaceae. CaMV был одним из первых изученных ДНК вирусов растений и его двойная кольцевая ДНК полностью отсеквенирована (Franck et al 1980). Регуляторные элементы этого вируса используются уже с 80х годов (Hohn et al 1982), и в особенности промотор 35S. Это сильный конститутивный промотор, обеспечивающий высокие уровни генной экспрессии при трансформации растений содержащими его конструкциями. 35S промотор широко используется в экспериментах по трансформации благодаря своей высокой активности в большинстве клеток широкого спектра видов растений.

Проведены исчерпывающие исследования его поведения во многих растениях и экспрессионных системах (см. обзор Hull et al., 2002). Структура 35S CaMV промотора подробно описана, а природа его взаимодействия с энхансерами хорошо понятна. Именно поэтому, эту последовательность мы выбрали в качестве сильного конститутивного вирусного промотора. Более того результаты предыдущего эксперимента с использованием именно этого промотора оказались весьма показательными.

Часть домена А промотора CaMV35S содержащая ТАТА бокс и располагающаяся в промежутке от -46 до +8 является коровой частью, так называемым 35S минимальным промотором (Benfey et al., 1990), наиболее сильно урезанной версией 35S CaMV, у которой все еще наблюдается детектируемый уровень экспрессии. Этот промотор был выбран нами как слабый вирусный.

RuBisCO (рибулозо-1,5-бисфосфаткарбоксилаза) - бифункциональный фермент хлоропластов растений, который катализирует инициацию процесса фиксации двуокиси углерода в цикле Кальвина и функционирует как оксигеназа при фотореспирации. RuBisCO, видимо, самый распространенный белок в мире.

Примерно половина растворимых белков в листе – это белки RuBisCO. У высших растений он состоит из двух субъединиц, большой (LSU), кодируемой в геноме хлоропластов, и малой (SSU), кодируемой ядерным геномом (Ellis, 1981). Органы растений содержат RuBisCo, в растворимой фракции может содержаться до 50% этого белка. Таким образом, промотор SSU изначально являлся привлекательным кандидатом для получения высоких уровней экспрессии в зеленых частях трансгенных растений (Ellis, 1981). Промотор малой субъединицы обеспечивает тканеспецифичную и регулируемую светом экспрессию генов (Khoudi et al. 1997) и он отлично подходит для генной инженерии растений (Jung et al. 2010; Kim et al.

2010; Kim et al. 2012). Этот промотор был использован нами в качестве сильного растительного промотора.

Установлено, что ранние индуцируемые светом белки семейства ELIP (Elip от Early light inducible protein) связаны в тилакоидах хлоропластов с фотосистемой II. Эти белки связаны со стрессом вызванным светом, холодом, или недостатком питательных веществ. В высших растениях они синтезируются в ядре в виде предшественников и попадают в хлоропласты уже посттрансляционно (Montane, Kloppstech, 2000). ELIP промотор томата, укороченный по HindIII сайту, в предварительных экспериментах в лаборатории экспрессионных систем и модификации генома растений ФИБХ РАН показал активность как в плодах, так и в листьях томата (неопубликованные данные). Он отлично подошел нам в качестве слабого растительного промотора, показывающего, тем не менее экспрессию во всех растительных органах.

Такая стратегия, при которой используются промоторы разного происхождения и разной силы, позволяет не только сравнить влияние элементов при экспрессии с сильного и слабого промоторов и отличия во влиянии на растительные промоторы, но и проанализировать значимость расположения элементов. В нашем случае последовательности располагались как по обе стороны от экспрессионной кассеты, так и только с одной стороны, выше первого промотора, т.к. предыдущий эксперимент показал эффективность такой локализации.

4.2.2 Конструирование Сборка экспрессионных конструкций проводилась в векторе, изначально созданном для сайленсинга в растениях - векторная система на базе pHANNIBAL (с геном -лактамазы в качестве бактериального маркера, рис.5). Из этого вектора Рисунок 5. Схематичное изображение вектора pHANNIBAL.

по сайтам NotI была вырезана смысловая конструкция и встроен синтезированный полилинкер. Экспрессионная кассета затем по этим же сайтам NotI может быть вырезана и в дальнейшем лигируется в бинарный вектор, в нашем случае pART27 (Gleave, 1992), который используется для трансформации растений. Выбор этого вектора для сборки мотивировался тем, что использованная его часть имеет достаточно маленький размер и лишь незначительное количество сайтов рестрикции. Это было весьма важным, т.к.

создаваемые нами конструкции имели значительный размер, а так же, в качестве регуляторных элементов, содержали терминаторные последовательности из генома арабидопсиса, каждая из которых, в свою очередь, несет большое количество сайтов узнаваемых рестриктазами.

Для создания такой системы была разработана последовательность полилинкера, содержащая определенное количество сайтов ферментативной рестрикции, рассчитанная непосредственно для последовательного клонирования элементов, необходимого для правильной сборки создаваемой конструкции. Для его создания были рассчитаны и заказаны олигонуклеотиды PolyH1 и PolyH2.

На их основе была синтезирована полилинкерная последовательность.

SpeI HindIII XhoI AatII NotI NarI XmaI PstI NheI SacII SphI NotI Сайты воздействия эндонуклеаз рестрикции выбирались с их учетом наличия в клонированных из арабидопсиса регуляторных последовательностях.

Выбраны были уникальные сайты рестрикции, такие которые впоследствии давали бы возможность заменить любую часть конструкции, не повреждая остальные составляющие.

Конструирование проводилось по схеме, представленной ниже. Процесс включал в себя несколько этапов, в зависимости от желаемого конечного результата.

1. а) Плазмида pHANNIBAL разрезалась по сайтам NotI и XhoI, и из геля выделяли вектор NotI- NotI, в который впоследствии проводили вставку полилинкера.

б) По сайтам NotI- NotI вставляли полилинкер в плазмиду.

2. По сайтам SphI-SacII клонировали последовательность araterm II.

3. а) По сайтам HindIII-XhoI вставляли RuBisCO или 35S CaMV.

RuBisCO был клонирован из вектора pBI121-t3A-rbcS-ppc-ocs (Ovchinnikova et al., 2008) с использованием праймеров RubhxDir и RubhxRev.

35SCaMV промотор был клонирован из стандартного вектора pBI121 (Jefferson et al., 1987) с использованием праймеров 35SpaDir и 35SpaRev

б) По сайтам XhoI-PstI клонировали последовательность GFPer+term Последовательность GFPer была получена в результате амплификации с праймеров GFPerxpDir и GFPerxpRev с плазмиды pBINmGFP5ER (Haseloff et al., 1997)

в) По сайтам AatII-NheI клонировали последовательность GUS+term Последовательность GUS была клонирована из вектора pBI121 (Jefferson et al., 1987) с использованием праймеров GUSanDir и GUSRev.

4 а) По сайтам XmaI-SpeI вставляли araterm IV

б) По сайтам NarI-XmaI вставляли araterm I 5 а) По сайтам NarI-SpeI в конструкцию, получившуюся в пункте 3, клонировали вырезанный по этим же сайтам фрагмент конструкции получившейся в пункте 4.

б) По сайтам PstI-AatII вставляли промоторы ELIP или 35Smin ELIP был амплифицировн с праймеров ElipDir и ElipRev.

Мини промотор был собран из олигонуклеотидов 35SminPA1 и 35SminPA2.

6. По сайтам NarI-NheI в конструкцию, получившуюся в пункте 2, клонировали вырезанный по этим же сайтам фрагмент конструкции из пункта 5 Для получения конструкций с терминирующими элементами с обоих концов выполняли все пункты. Для получения терминаторов только с одного конца – пропускались пункты 2 и 6. Для создания контрольной конструкции, не содержащей регуляторных элементов, были выполнены только пункты 1, 3 и 5б.

Выбранная нами стратегия клонирования позволила создать следующие комбинации используемых элементов (рис. 6), каждая из которых представляет научный интерес для исследования влияния новых элементов на трансгенную экспрессию:

Обе группы регуляторных элементов присутствуют в конструкции, при этом гены репортерных белков находятся под контролем сильных промоторов Обе группы регуляторных элементов присутствуют в конструкции, при этом гены репортерных белков находятся под контролем слабых промоторов Присутствует группа регуляторных элементов, находящаяся лишь с одной стороны от экспрессионной кассеты, при этом гены репортерных белков находятся под контролем сильных промоторов Присутствует группа регуляторных элементов, находящаяся лишь с одной стороны от экспрессионной кассеты, при этом гены репортерных белков находятся под контролем слабых промоторов Ни одной из групп исследуемых элементов нет в экспрессионном векторе - это контрольная конструкция Наличие четырех вариантов комбинации исследуемых растительных регуляторных элементов и промоторов разной силы, влияющих на ход экспрессии двух различных репортерных белков, позволило оценить степень влияния новых растительных терминаторов на уровень и вариабильность экспрессии белка, в экспрессионной кассете которого они содержатся.

В дальнейшем, каждая из экспрессионных кассет была вырезана по фланкирующим сайтам рестрикции из вектора, использующегося для сборки кассет, и рядом последовательных клонирований перемещена непосредственно в вектор pART27 (Gleave, 1992), который в дальнейшем использовался для трансформации растительных тканей.

4.2.3 Генетическая трансформация растений

Трансформация проводилась по той же методике, что и в первом эксперименте. Для каждой плазмиды было взято по 50 эксплантов, получены независимые регенеранты, которые в дальнейшем селектировались на среде с канамицином и проверены на наличие экспрессии гена GFP микроскопированием (табл. 3). Каждая линия так же гистохимически проверялась на наличие экспрессии гена GUS, для первоначального подтверждения наличия экспрессионной кассеты в геноме растения. Все растения с подтвержденным наличием GFP давали положительный ответ и при гистохимическом анализе GUS.

Рисунок 6. Схематичное изображение использованных в работе конструкций.

Промоторы показаны в виде стрелок. Обозначения: 35S, промотор CaMV 35S; 35Smin, -49 to +8 участок промотора CaMV 35S, RuBisCO, промотор гена малой субъединицы рибулозо-1,5-бисфосфат карбоксилазы томата (rbcS) c интроном, ELIP, укороченный по HindIII сайту промотор белка светового стресса ELIP; LB, RB -последовательности левой и правой границ Т-ДНК.

Растения с детектируемой экспрессией GFP и GUS клонально размножались в условиях in vitro. По шесть клонов было адаптировано и перенесено в условия защищенного грунта. Все линии были проверены на отсутствие бактериальной контаминациии и на присутствие гена селективного маркера методом ПЦР (табл.

3). Так как перенос Т-ДНК осуществляется от правой к левой границы, то присутствие селективного маркера, расположенного у левой границы (LB), с высокой долей вероятности свидетельствует о успешном переносе полноразмерной кассеты экспрессии.

Таблица 3. Результаты трансформации листовых эксплантов табака конструкциями с растительными элементами.

aКонструкции представлены на Рис.6

–  –  –

4.2.4 Анализ уровня экспрессии репортерных генов Анализ уровня экспрессии GUS производился так же, методами флюориметрии. Исследование количества и уровня экспрессии репортерного белка GFP проводилось методом иммуноферментного анализа.

Иммуноферментный анализ (Enzyme immunoassay) это метод выявления антигенов и антител, основанный на определении комплекса антиген-антитело за счет введения в один из компонентов реакции ферментативной метки с последующей ее детекцией с помощью соответствующего субстрата, изменяющего свою окраску. Определение общего белка экстракта проводилось, как и в первом случае, по методике Бредфорд, но уже с использованием готовых наборов.

Исходя из данных, представленных в таблице 4 (так же рис. 7), можно сказать, что влияние на экспрессию с промотора 35S в сторону ее увеличения оказывают лишь регуляторные элементы, находящиеся только с одной стороны от экспрессионной кассеты (в конструкции pBI35SI-IV), что согласуется с предыдущими результатами, для регуляторных элементов I и II. Однако в случае RuBisCO это влияние хорошо выражено в конструкциях и pBIERI-IV и pBIERII. Более того, при фланкировании регуляторными элементами экспрессионной кассеты с обеих

–  –  –

A Б Рисунок 7. Влияние АT-элементов на экспрессию GFP и активность GUS в трансгенных растениях табака. (A) Средний уровень экспрессии eGFP в мкг на мг общего растворимого белка ± стандартная ошибка (SE); (Б) Средняя активность GUS в нмоль 4-метил-умбеллиферона в мин на мг общего белка с ± стандартной ошибкой (SE). Статистически достоверные отличия между группами и контролем отмечены одной звездочкой (p0,05) или двумя (p0,1).

4.3 Статистическая обработка результатов

Наиболее адекватным методом для решения нашей задачи было проведение двухфакторного иерархического дисперсионного анализа, где в качестве первого фиксированного фактора выступало наличие изучаемых элементов в конструкции, а в качестве второго (случайного) - возможные различия между линиями с одной экспрессионной конструкцией. Принятие во внимание второго фактора позволяет оценить влияние изучаемых нами регуляторных элементов на экспрессию репортерных генов под разными промоторами, нивелируя влияние места встраивания экспрессионной кассеты и ее копийности, т.к. все это включает в себя анализ данных в качестве влияющего фактора. Такой подход позволяет обойтись без дополнительных экспериментов, таких, например, как Саузерн блот. Более того дисперсионный анализ позволяет изучить влияние первых двух факторов на фоне повторяемости данных - ошибки измерения. В нашем случае причиной этой вариабельности стало различие между клонами одной линии.

Дисперсионный анализ, основы которого были разработаны Фишером в 1920-1930 гг., позволяет устанавливать не только степень одновременного влияния на признак нескольких факторов и каждого в отдельности, но также их суммарное влияние в любых комбинациях и дополнительный эффект от сочетания разных факторов. Дисперсию измеряемого признака разлагают на независимые слагаемые, каждое из которых характеризует влияние того или иного фактора или их взаимодействия. Последующее сравнение таких слагаемых позволяет оценить значимость каждого изучаемого фактора, а также их комбинации. Разумеется, и в этом случае остается масса неучтенных факторов, но, во-первых, методика позволяет оценить долю их влияния на общую изменчивость признака, а вовторых, исследователь обычно имеет возможность выделить несколько ведущих факторов и исследовать именно их воздействие на изменчивость признаков.

Дисперсионный анализ – анализ изменчивости признака под влиянием каких-либо контролируемых переменных факторов в зарубежной литературе именуется ANOVA – «Analisis of Variance». Вариативность, обусловленная действием исследуемых переменных и их взаимодействием, соотносится со случайной вариативностью. Показателем этого соотношения является F – критерий Фишера.

В иерархической модели (nested ANOVA) подразумевается, что один фактор – основной, а внутри основного фактора каждый уровень может быть разделен на подуровни главного фактора.

В формулу расчета критерия F вводят оценки дисперсий, и, следовательно, этот метод относится к разряду параметрических. Чем в большей степени вариативность признака обусловлена исследуемыми переменными или их взаимодействием, тем выше эмпирические значения критерия F. Основная идея дисперсионного анализа состоит в сравнении групповой дисперсии, порождаемой воздействием фактора и остаточной дисперсии, обусловленной случайными причинами. Если различие между этими дисперсиями значимо, то фактор оказывает существенное влияние на измеряемую величину. В этом случае средние наблюдаемых значений на каждом уровне также значимо различаются.

Математическая модель, на которой основано вычисление критических значений F, предполагает следующее:

1.Каждая выборка независима от остальных выборок.

2.Каждая выборка случайным образом извлечена из исследуемой совокупности.

3.Совокупность нормально распределена.

4.Дисперсии всех выборок равны.

При существенном нарушении хотя бы одного из этих условий нельзя пользоваться дисперсионным анализом. В этом случае надо использовать его непараметрический аналог.

4.3.1 Ограничения дисперсионного анализа и подготовка данных

–  –  –

нормальным. Однако полученные нами данные имели распределение далекое от нормального и сильно отличались друг от друга. В связи с этим в целях сглаживания распределения они были прологарифмированы по основанию 10 и дальнейшие расчеты и анализы проводились уже для преобразованных данных.

Так же для уравнивания числа значений случайным образом были отобраны линии, данные по которым далее не принимали участие в обработке (см. ниже). В результате этих преобразований для первого эксперимента было проанализировано только по 4 линии из каждой конструкции.

Для проверки нормальности распределения следует провести расчеты ассимметрии и эксцесса по следующим формулам:

A = (xi – xср)3 / n3 mA= 6/n E = ( (xi – xср)4 / n4 ) - 3 mE= 26/n,



Pages:     | 1 | 2 || 4 | 5 |

Похожие работы:

«Искам Николай Юрьевич ЭФФЕКТИВНОСТЬ ИСПОЛЬЗОВАНИЯ НОВОЙ КОРМОВОЙ ДОБАВКИ АЦИД-НИИММП НА ОСНОВЕ ОРГАНИЧЕСКИХ КИСЛОТ ПРИ ПРОИЗВОДСТВЕ ГОВЯДИНЫ 06.02.10 – частная зоотехния, технология производства продуктов животноводства; 06.02.08 – кормопроизводство, кормление сельскохозяйственных животных и технология кормов. ДИССЕРТАЦИЯ на...»

«КОЛОТВИН АНДРЕЙ ВАСИЛЬЕВИЧ Прогностическая значимость генетического полиморфизма патогена и хозяина для оценки эффективности терапии и развития фиброза печени при хроническом гепатите С Молекулярная биология –...»

«Радугина Елена Александровна РЕГУЛЯЦИЯ МОРФОГЕНЕЗА РЕГЕНЕРИРУЮЩЕГО ХВОСТА ТРИТОНА В НОРМЕ И В УСЛОВИЯХ ИЗМЕНЕННОЙ ГРАВИТАЦИОННОЙ НАГРУЗКИ 03.03.05 – биология развития, эмбриология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: Доктор биологических наук Э.Н. Григорян Москва – 2015 Оглавление Введение Обзор литературы 1 Регенерация...»

«АРУТЮНЯН ЛУСИНЕ ЛЕВОНОВНА МНОГОУРОВНЕВЫЙ АНАЛИЗ СОСТОЯНИЯ КОРНЕОСКЛЕРАЛЬНОЙ ОБОЛОЧКИ ГЛАЗА В РЕАЛИЗАЦИИ НОВЫХ ПОДХОДОВ К ДИАГНОСТИКЕ И ЛЕЧЕНИЮ ПЕРВИЧНОЙ ОТКРЫТОУГОЛЬНОЙ ГЛАУКОМЫ 14. 01. 07 глазные болезни Диссертацияна соискание ученой степени доктора медицинских наук Научные консультанты:...»

«ПОДОЛЬНИКОВА ЮЛИЯ АЛЕКСАНДРОВНА ОСОБЕННОСТИ СВОБОДНОРАДИКАЛЬНОГО СТАТУСА МОЛОКА КОРОВ УРБАНИЗИРОВАННОЙ ТЕРРИТОРИИ (НА ПРИМЕРЕ ОМСКОЙ ОБЛАСТИ) Специальность: 03.02.08 – экология ДИССЕРТАЦИЯ на соискание степени кандидата биологических наук Научный руководитель: Заслуженный работник высшей школы РФ доктор...»

«Карачевцев Захар Юрьевич ОЦЕНКА ПИЩЕВЫХ (АКАРИЦИДНЫХ) СВОЙСТВ РЯДА СУБТРОПИЧЕСКИХ И ТРОПИЧЕСКИХ РАСТЕНИЙ В ОТНОШЕНИИ ПАУТИННОГО КЛЕЩА TETRANYCHUS ATLANTICUS MСGREGOR Специальность: 06.01.07 – защита растений Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель: Попов Сергей...»

«КОПИЙ ВЕРА ГЕОРГИЕВНА УДК 574.587 (252.5) СООБЩЕСТВА МАКРОЗООБЕНТОСА ПЕСЧАНОЙ ПСЕВДОЛИТОРАЛИ У ЧЕРНОМОРСКИХ БЕРЕГОВ КРЫМА Специальность 03.02.10 – гидробиология Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель Заика Виктор Евгеньевич член-корреспондент НАН Украины, доктор биологических наук, профессор Севастополь 2014 СОДЕРЖАНИЕ ВВЕДЕНИЕ..4 РАЗДЕЛ 1. СОСТОЯНИЕ ИЗУЧЕННОСТИ...»

«Кофиади Илья Андреевич ИММУНОГЕНОТИПИРОВАНИЕ И ГЕНОДИАГНОСТИКА В БИОМЕДИЦИНЕ: ФУНДАМЕНТАЛЬНЫЕ И ПРИКЛАДНЫЕ АСПЕКТЫ «03.03.03 – иммунология» диссертация на соискание ученой степени доктора биологических наук Москва, 2013 ОГЛАВЛЕНИЕ СПИСОК ИСПОЛЬЗОВАННЫХ В РАБОТЕ СОКРАЩЕНИЙ 8 ВВЕДЕНИЕ 1. ОБЗОР ЛИТЕРАТУРЫ 1.1 ИСТОРИЯ РАЗВИТИЯ...»

«Мансуров Рашид Шамилович Применение препарата Солунат при выращивании бройлеров 06.02.08. – кормопроизводство, кормление сельскохозяйственных животных и технология кормов Диссертация на соискание ученой степени кандидата сельскохозяйственных наук Научный руководитель: доктор биологических наук, профессор, Заслуженный деятель науки Российской...»

«МАХАЧЕВА ХАННА ГАДЖИЕВНА СОСТОЯНИЕ И ПЕРСПЕКТИВЫ МОДЕРНИЗАЦИИ ОТОРИНОЛАРИНГОЛОГИЧЕСКОЙ ПОМОЩИ В РЕСПУБЛИКЕ ДАГЕСТАН 14.01.03 – болезни уха, горла и носа 14.02.03 – общественное здоровье и здравоохранение Диссертация на соискание ученой степени доктора медицинских наук Научные консультанты: доктор медицинских наук, профессор Н.А. Дайхес доктор медицинских наук, профессор Л.М. Асхабова...»

«Будилова Елена Вениаминовна Эволюция жизненного цикла человека: анализ глобальных данных и моделирование 03.02.08 – Экология Диссертация на соискание ученой степени доктора биологических наук Научный консультант доктор биологических наук, профессор А.Т. Терехин Москва 2015 Посвящается моим родителям, детям и мужу с любовью. Содержание Введение.. 5 1. Теория эволюции жизненного цикла. 19...»

«ДЕНИСЕНКО ВАДИМ СЕРГЕЕВИЧ ОПЕРЕЖАЮЩАЯ ФИЗИЧЕСКАЯ ПОДГОТОВКА СТУДЕНТОВ УЧЕБНЫХ ЗАВЕДЕНИЙ СФЕРЫ ФИЗИЧЕСКОЙ КУЛЬТУРЫ В КОНТЕКСТЕ ОБЕСПЕЧЕНИЯ НЕПРЕРЫВНОСТИ ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ 13.00.04 – Теория и методика физического воспитания, спортивной тренировки, оздоровительной и адаптивной физической культуры ДИССЕРТАЦИЯ на соискание...»

«Смешливая Наталья Владимировна ЭКОЛОГО-ФИЗИОЛОГИЧЕСКИЕ АСПЕКТЫ РЕПРОДУКТИВНОЙ ФУНКЦИИ СИГОВЫХ РЫБ ОБЬ-ИРТЫШСКОГО БАССЕЙНА 03.02.06 Ихтиология Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель кандидат биологических наук, доцент Семенченко С.М. Тюмень – 2015 ОГЛАВЛЕНИЕ...»

«МУСТАФАЕВ РОВШАН ДЖАЛАЛ ОГЛЫ «СОВРЕМЕННЫЕ ЛАЗЕРНЫЕ ТЕХНОЛОГИИ В ЛЕЧЕНИИ ПЕРИТОНИТА» (Экспериментально-клиническое исследование) Диссертация на соискание ученой степени доктора медицинских наук по специальности–14.01.17 хирургия Научный консультант: доктор медицинских наук, профессор Гейниц А.В. Москва 2014 СПИСОК ПРИНЯТЫХ В РАБОТЕ...»

«СИНЕЛЬЩИКОВА Александра Юрьевна Ночная миграция дроздов рода Turdus в юго-восточной Прибалтике Специальность 03.02.04 – Зоология Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель: доктор биологических наук, профессор, главный научный сотрудник К.В. Большаков Санкт-Петербург Оглавление Введение... 3 Глава 1. Особенности миграции...»

«ВУДС ЕКАТЕРИНА АНАТОЛЬЕВНА Фармакогенетические аспекты антиангиогенной терапии экссудативной формы возрастной макулярной дегенерации» 14.01.07 – Глазные болезни ДИССЕРТАЦИЯ на соискание учёной степени кандидата медицинских наук Научные руководители: доктор медицинских наук Будзинская Мария Викторовна кандидат биологических наук Погода Татьяна Викторовна Москва – 2015...»

«Лямина Наталья Викторовна УДК 591.148:574.52(262.5) ДИНАМИКА ПАРАМЕТРОВ ПОЛЯ БИОЛЮМИНЕСЦЕНЦИИ В ЧЁРНОМ МОРЕ И ИХ СОПРЯЖЁННОСТЬ С ФАКТОРАМИ СРЕДЫ 03.02.10 – гидробиология Диссертация на соискание учной степени кандидата биологических наук Научный руководитель д.б.н., профессор Ю. Н. Токарев Севастополь 2014 г. СОДЕРЖАНИЕ Стр. ПЕРЕЧЕНЬ УСЛОВНЫХ ОБОЗНАЧЕНИЙ И СОКРАЩЕНИЙ, СИМВОЛОВ, ЕДИНИЦ И ТЕРМИНОВ. ВВЕДЕНИЕ.. РАЗДЕЛ ИСТОРИЯ...»

«ПИМЕНОВА ЕКАТЕРИНА ВЛАДИМИРОВНА РАЗРАБОТКА МЕТОДА ОЦЕНКИ ЦИТОТОКСИЧНОСТИ АНТИГЕНОВ ВОЗБУДИТЕЛЯ МЕЛИОИДОЗА IN VITRO НА МОДЕЛИ ПЕРЕВИВАЕМЫХ КЛЕТОЧНЫХ КУЛЬТУР 03.02.03 – микробиология Диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор...»

«СЕРГЕЕВА ЛЮДМИЛА ВАСИЛЬЕВНА ПРИМЕНЕНИЕ БАКТЕРИАЛЬНЫХ ЗАКВАСОК ДЛЯ ОПТИМИЗАЦИИ ФУНКЦИОНАЛЬНО-ТЕХНОЛОГИЧЕСКИХ СВОЙСТВ МЯСНОГО СЫРЬЯ И УЛУЧШЕНИЯ КАЧЕСТВА ПОЛУЧАЕМОЙ ПРОДУКЦИИ Специальность 03.01.06 – биотехнология ( в том числе бионанотехнологии) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель Доктор биологических наук, профессор Кадималиев Д.А. САРАНСК 2014 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ.....»

«БАБЕШКО Кирилл Владимирович ЭКОЛОГИЧЕСКИЕ ПРЕДПОЧТЕНИЯ СФАГНОБИОНТНЫХ РАКОВИННЫХ АМЕБ И ИХ ИСПОЛЬЗОВАНИЕ ДЛЯ РЕКОНСТРУКЦИИ ГИДРОЛОГИЧЕСКОГО РЕЖИМА БОЛОТ В ГОЛОЦЕНЕ Специальность 03.02.08 – экология (биология) диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: кандидат биологических наук Цыганов...»







 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.