WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 


Pages:     | 1 || 3 | 4 |   ...   | 5 |

«ЗАЩИТА ЭКСПРЕССИИ ГЕТЕРОЛОГИЧНЫХ ГЕНОВ В ТРАНСГЕННЫХ РАСТЕНИЯХ ПОСРЕДСТВОМ ДНК-ПОСЛЕДОВАТЕЛЬНОСТЕЙ, ТЕРМИНИРУЮЩИХ ТРАНСКРИПЦИЮ. Диссертация на соискание ученой степени кандидата биологич ...»

-- [ Страница 2 ] --

Низкая частота является главным препятствием, но современный прогресс в адресном влиянии на гены, так же, как и накапливание знаний о регуляции уровней рекомбинации, являются обнадеживающими предзнаменованиями будущего развития подходов трансформации растений, основанных на гомологичной рекомбинации.

2.4.3 Дизайн конструкций

Кроме разработки методов трансформации растений, управляемая трансгенная экспрессия в растительных клетках требует создания экспрессионных кассет содержащих в себе сам ген (или гены) и подходящие регуляторные последовательности для достижения целевой экспрессии вводимого гена.

2.4.3.1 Промоторы Применение соответствующих промоторов и терминаторов сильно влияет на экспрессию генов. На заре исследований трансформации растений для управления трансгенной экспрессией главным образом использовались промоторы и терминаторы из опухолеиндуцирующих (Ti) плазмид A. tumefaciens (например, pNOS и tNOS; Depicker et al., 1982). С тех пор было проведено много исследований для выделения и описания характеристик более сильных конститутивных промоторов, так как многие области биотехнологии растений нуждаются в стабильной трансгенной экспрессии на высоких уровнях. В целом сильными конститутивными промоторами для растений считаются широко используемый промотор вируса мозаики цветной капусты CaMV p35S (Cauliflower mosaic virus promoter, Odell et al., 1985), промотор вируса мозаики маниоки pCAS (Cassava Vein Mosaic Virus promoter; Verdaguer et al., 1996) и растительные промоторы, которые отвечают за ситнез генов домашнего хозяйства, такие как, например, убиквитиновые (pUBI; e.g. Binet et al., 1991). Последние исследования показали, что сравнимыми по эффективности с CaMV p35S могут быть промоторы фактора трансляции SUI1 и рибосомального белка L36, полученные из такого растения как ананас (Koia et al., 2013). В настоящее время для повышения эффективности экспрессии встраиваемых генов в экспериментах стали использовать и тканеспецифичные промоторы, которые позволяют белку накапливаться в определенных органах и тканях (Hiwasa-Tanase et al. 2012).

2.4.3.2. 5'-UTR последовательности Работы ряда исследовательских групп говорят об увеличении трансгенной экспрессии при использовании экспрессионных кассет содержащих оптимизированные 5' и 3' регуляторные последовательности, представляющие собой участки ДНК, соответствующие 5'- и 3'- нетранслируемым областям транскрипта иРНК (5'-и 3'-UTR). Еще в 1987 году (Gallie et al., 1987) было показано, что 5'-UTR последовательность из штамма U1 вируса табачной мозаики TMV (tobacco mosaic virus), сейчас известная как -последовательность, сильно увеличивает уровень экспрессии репортерного гена. Последующие исследования показали, что -последовательность является энхансером как при стабильной, так и при транзиентной трансгенной экспрессии в табаке и рисе (Mitsura et al., 1996).

Дальнейшие работы показали, что и 5'-UTR последовательности высших растений также обладают энхансерным воздействием. Например, регуляторные последовательности запасных белков из семян фасоли обыкновенной (Phaseolus vulgaris), -фазеолиновый промотор в комбинации с терминатором гена arcelin 5-I, повышают экспрессию гетерологичного белка в семенах двудольных до 36% от общего растворимого белка семян гомозиготных растений, вместо 1% при использовании 35S промотора (De Jaeger et al., 2002). Другая работа описывает создание экспрессионной кассеты с нетранслируемыми 5' и 3' регионами гена хризантем, кодирующего малую субъединицу рибулозо-1,5бифосфаткарбоксилазы (rbcS1). При использовании rbcS1-кассеты, уровень трансгенной экспрессии достиг в листьях табака 10% от общего растворимого белка (Outchkourov et al., 2003). В 2004 году на предмет влияния на уровень экспрессии была проверена 5'-UTR последовательность гена алкогольдегидрогеназы (NtADH), выделенного из суспензионной культуры клеток табака BY-2. При использовании репортерного гена GUS, было показано, что применение этой последовательности увеличивает уровень трансгенной экспрессии в 30-100 раз в случае культуры клеток BY-2 и в 30-60 раз для культуры клеток арабидопсиса Т87. Таким образом, по эффективности своего воздействия эта последовательность сравнима с признанным трансляционным энхансером.

Правда уровень экспрессии в культуре клеток риса Oruza sativa, также протрансформированной конструкцией содержащей 5'-UTR последовательность NtADH, изменился лишь незначительно (Saton et al. 2004). Однако, использование интрона из 5'-UTR последовательности гена rubi3 самого риса, эффективно усиливающей трансгенную экпрессию (Lu et al., 2003, 2008), обеспечило 26кратное увеличение уровня экспрессии репортерного гена GUS (Sammader et al.

2008). 5'UTR цитозольной формы глютамин синтетазы так же ведет себя как энхансер в растительных клетках, увеличивая уровень экспрессии репортерного гена примерно в 20 раз (Ortega et al., 2012). SynJ, синтетическая 5'UTR последовательность может усиливать трансгенную экспрессию белка, даже находящегося под таким сильным промотором как CaMV 35S (Kanoria and Burma, 2012).

2.4.3.3 Интроны Кроме промоторов и терминаторов на уровень трансгенной экспрессии в растениях влияют присутствие в гене последовательностей интронов и их положение (Rethmeier et al. 1997; Bourdon et al. 2001; Rose 2004, Emami et al.

2013). Опосредованное интроном усиление экспрессии генов IME (Intron-Mediated Enhancement) как правило вызывает увеличение уровня экспрессии гетерологичного гена в 2-10 раз, по сравнению с идентичной конструкцией без интрона. Причем в однодольных разница может быть значительно больше (Maas et al., 1991; Zhang et al., 1994). Сила IME зависит от используемых промоторрепортерных систем (Callis et al., 1987; Luehrsen & Walbot,1991; Rethmeier et al., 1998), последовательностей фланкирующих интрон (Maas et al, 1991; Clancy et al.,

1994) и типа ткани в которой проходит экспрессия (Gallie & Young, 1994).

Несмотря на то, что высокая степень изменчивости экспрессии в растениях делает сравнение между исследования достаточно трудным, увеличение экспрессии, опосредованной интронами, можно заметить на уровне мРНК (Callis et al 1987;

Dean et al 1989; Rethmeier et al, 1997; Rose & Last, 1997; Wang et al, 2002).

Все эти примеры говорят о том, что надо внимательно и осторожно выбирать регуляторные элементы для их использования в определенных конструкциях. Оптимизация и внедрение специфических регуляторных последовательностей могут значительно увеличить уровень трансгенной экспрессии и снизить её вариабельность.

2.4.4 MAR-элементы

Последовательности ДНК, обладающие способностью связывания с ядерным матриксом, получили название MARs (matrix attachment regions).

Влияние MAR на экспрессию в растениях изучено гораздо меньше, чем в животных организмах и первые исследования в этой области проводились с использованием гетерологичных MAR. Куриная матрикс связывающая последовательность лизоцима курицы (А-элемент) – один из наиболее изученных MAR позвоночных, он был использован и для воздействия на экспрессию в растениях. При биолистической доставке ДНК этот элемент усиливал уровень экспрессии в 36 раз (Odell and Krebbers, 1998). Однако такой значимый эффект был замечен только в культуре клеток кукурузы. Тем не менее его влияние в растениях табака при использовании в качестве переносчика ДНК бактерий A.tumefaciens тоже является достаточно значимыми, более того, элемент А, в некоторых случаях, приводил так же и к довольно заметному снижению вариабельности экспрессии. Можно сказать, что это единственный из матрикссвязывающих элементов, который так значительно влияет на вариабельность экспрессии в растениях, снижая её в семь-восемь раз (Mlynarova et al., 1994,1995).

Вместе с тем, в 2003 году для этой последовательности, были однозначно доказаны ее протекторные свойства, ограждающие экспрессию репортерного гена от РНК-сайленсинга (Mlynarova et al., 2003). Были исследованы и другие матрикс связывающие элементы курицы (Butaye et al., 2004; Oh et al., 2005; De Bolle et al., 2007), однако такого заметного влияния на экспрессию у полноценных растений ни один из них не оказал. Кроме регуляторных элементов курицы, в растениях также исследовалось влияние и других чужеродных MAR – человеческого globin-SAR (Breyne et al., 1992) и ARS-1 из дрожжей (Allen et al., 1993; Vain et al., 1999; Holmes-Davis and Comai, 2002). И если человеческий элемент не оказал никакого воздействия кроме незначительного снижения вариабельности, использование последовательностей дрожжей усиливало экспрессию, находящуюся под 35S промотором, в 3-12 раз при биолистической трансформации, в клетках табака и в растениях риса (Allen et al.

, 1993; Vain et al., 1999). В последствии, однако, стали использоваться MAR идентифицированные в самих растениях. Около трети подобных исследований, начиная с 1996 года (Allen et al., 1996), включали в себя изучение MAR-последовательности табака RB7. Эта последовательность длиной 1166 нп, эффективно связывающаяся с ядерным матриксом, содержит весь набор последовательностей характерных для MARэлементов: А-бокс, Т-бокс, сайты связывания топоизомеразы, ARSпоследовательности и G-содержащие регионы. Несмотря на то, что использование RB7 MAR не приводило к снижению вариабельности, практически во всех экспериментах этот элемент на порядок увеличивал уровень экспрессии репортерного гена, в некоторых случаях до 650 раз (Cheng et al., 2001). Только в растениях тополя при полевых условиях его использование не вызвало положительных изменений в уровне экспрессии, хотя в эксплантах приводило к семи-девяти кратному увеличению (Han et al., 1997; Li et al., 2008). Однако и в этом случае было отмечено положительное влияние, выражавшееся в снижении числа слабо экспрессирующих линий. На самом деле такое поведение довольно характерно для MAR элементов. Многие из них, вне зависимости от влияния на уровень экспрессии, снижают количество молчащих и слабоэкспрессирующих линий и клеток (Han et al., 1997; Mankin et al., 2003; Maximova et al., 2003; Xue et al., 2005; Abranches et al., 2005; Li et al., 2008). Для RB7 MAR было показано и другое его свойство. Наряду с усилением трансгенной экспрессии и увеличением процентного соотношения экспрессирующих линий RB7, помимо этого, стабилизирет экспрессию в растениях во время их развития, предотвращая сайленсинг и замолкание генов (Abranches et al., 2005). Так же для RB7 отчетливо видно, что лучшие результаты он показывает при билистической доставке экспрессионной кассеты, тогда как при использовании Т-ДНК, экспрессия возрастает не более чем в девять раз. Хотя, скорее всего, завышенные уровни экспрессии при использовании MAR в культуре клеток при баллистической трансформации вызваны быстроделящимися, недиффиринцированными клетками, нежели какими-то уникальными способностями RB7 MAR или преимуществами прямой доставки ДНК. Всего двумя работами ограничилось и исследование влияния MAR-последовательностей арабидопсиса (обе проводились на растениях табака). Ни один из использованных элементов не оказал влияния на вариабельность, но, все же, At MAR проявил себя как эффективный регуляторный элемент, увеличивая экспрессию репортерного белка в пять-десять раз (Liu and Tabe, 1998). Два других элемента арабидопсиса, исследованных позднее, не оказали такого сильного воздействия (Zhang et al., 2002). MARпоследовательности самого табака, даже не беря в расчет RB7, использовались в работах так же довольно часто. Некоторые из них достаточно эффективны и усиливают экспрессию в пять - десять раз: TM2 (Zhang et al., 2002, 2009; Xue et al., 2005), TM6 (Ji et al., 2013) и CHN50 MAR (Fukuda and Nishikawa, 2003). Кроме уже перечисленных растительных матрикс-связывающих элементов неплохой эффект можно отметить и у некоторых MAR бобовых. Например, SARL сои увеличивает концентрацию белка примерно так же, как и TM2 (Schffl et al., 1993), а phas MAR фасоли (van der Geest et al., 1994) и pea MAR гороха (Li et al.,

2001) примерно в два-три раза.

Более того, для некоторых MAR было обнаружено их влияние не только на уровень экспрессии гена, но также и на частоту трансформации, благодаря усилению экспрессии nptII гена (Zhang et al. 2007; Ji et al., 2013). И хотя в основном MAR элементы используются только для улучшения трансгенной экспрессии и предотвращения сайленсинга генов, эта способность позволяет применять MAR элементы и для достижения более высокой эффективности трансформации как в однодольных, так и в двудольных растениях.

В целом результаты исследований влияния MAR на трансгенную экспрессию в растениях до сих пор остаются весьма неоднозначными. Причиной этого является, вероятно, как наше ограниченное представление о ядерной организации и ядерном матриксе в целом, так и недостаточное количество исследований о связывании MAR с хроматином в растительных системах и механизмов их влияния. Например, некоторые MAR показывают себя как полноценные инсуляторные последовательности (TBS MAR, phas 3' MAR), некоторые нет (ADH1 и RB7 MAR), а для большинства, таких данных опять же просто нет (Hily et al., 2009). С другой стороны, однозначно показано, что анализ связывания с ядерным матриксом коррелирует с силой воздействия элемента и, соответственно, может предшествовать выбору MAR, для создания конструкций (Zhang et al. 2002). Тем более, даже сейчас видно, что некоторые MAR, например RB7, уже могут применяться на практике для усиления трансгенной эксперессии коммерчески важных белков в сельскохозяественных культурах, моделируя их свойства и увеличивая устойчивость к биотическим и абиотическим стрессам, что является одной из главных задач в этой области.

2.4.5 Вирусная супрессия сайленсинга генов

Для широкомасштабных исследований функций растительных генов для больших объемов генома доказана эффективность применения метода замолкания РНК (Wang and Waterhouse, 2002, Waterhouse and Helliwell, 2003). По большей части, разработка шпилечных конструкций (Helliwell and Waterhouse, 2003) и конструкций для вирус-индуцируемого подавления генов растений (VIGS, virus induced gene silencing) (Johansen and Carrington, 2001; Lu et al., 2003; Burch-Smith et al., 2004), снижающих уровень генной экспрессии, значительно усовершенствовала возможности функциональных геномных исследований. С другой стороны, РНК сайленсинг сильно усложняет фенотипические анализы и создание коммерчески выгодных культур, с предсказуемым и стабильным проявлением генов. Другим способом борьбы с нежелательно низким уровнем экспрессии является применение известных на данный момент знаний о механизмах умолкания РНК в технологиях трансформации. По-видимому, некоторые вирусные гены кодируют белки, которые подавляют РНК умолкание.

Скорее всего, они возникли эволюционным путем в противовес упомянутому выше антивирусному механизму (Roth et al., 2004). Высокий уровень экспрессии был достигнут комбинированием такого подхода с использованием более специфического вирусного супрессора PTGS, вспомогательного компонента протеиназы (HC-Pro helper component-proteinase) вируса гравировки табака (TEV Tobacco Etch Virus). В листьях взрослых растений табака уровень экспрессии белков увеличился до 3% от общего растворимого белка, благодаря коэкспрессии HC-Pro и PVX-ампликона (Mallory et al. 2002). Однако следует отметить, что трансгенные растения с HC-Pro часто страдают от заметных фенотипических аномалий, задержки в росте и обладают изменённой формой листьев (Pruss et al.

2004). Следовательно, такая методика скорее подходит для получения растений с высоким уровнем экспрессии гетерологичных генов, чем для фенотипических исследований. Еще в одной подобной стратегии используется система транзиентной экспрессии основанная на коэкспрессии гетерологичного гена и супрессора сайленсинга генов р19 вируса кустистой карликовости томатов (TBSV tomato bushy stunt virus). Опыт проводился на репортерном гене GFP, и его продукция в присутствии р19 увеличилась более чем в 50 раз за счет предотвращения PTGS в протрансформированных тканях (Voinnet et al. 2003).

Коэкспрессия гетерологичного гена и гена вирусного супрессора как таковая, может оказаться привлекательным методом для снижения вариабельности трансгенной экспрессии вызванной РНК умолканием.

2.4.6 Растения мутантные по одной или нескольким составляющим механизма РНК-сайленсинга Другим подходом преодоления негативного влияния замолкания РНК при трансгенной экспрессии оказалось использование PTGS мутантов, как мишеней для трансформации. Исследования мутантов A. thaliana ослабленных по PTGS привели к идентификации некоторых генов, которые предположительно играют роль в механизме PTGS, включая гены кодирующие предполагаемую РНК зависимую РНК полимеразу (RdRp) (SGS2/SDE1/RDR6; Dalmay et al. 2000;

Mourrain et al. 2000; Xie et al. 2004), биспиральный белок неизвестной функции (SGS3; Mourrain et al. 2000), РНК-хеликазу (SDE3; Dalmay et al. 2001) и белок содержащий PAZ и Piwi домены (AGO1; Fagard et al. 2000). В работе 2004 года (Butaye et al. 2004) было показано, что стабильная экспрессия высокого уровня может быть получена применением мутантов A. thaliana по PTGS sgs2 and sgs3, при этом нарушая типичную бимодальную систему экспрессии для генов под 35Sпромотором в растениях дикого типа. В популяции первого поколения растений арабидопсиса протрансформированных репортерным геном gusA под 35Sпромотором распространение растений с высоким уровнем экспрессии изменилось от 20% у дикого типа до 100% у линий sgs2 и sgs3. В соответствии с результатами полученнными для GUS, экспрессия GFP в растениях дикого типа была гораздо ниже и более нестабильной, по сравнению с sgs2, где все индивидуумы обладали чистым фенотипом. Так же, когда sgs2 мутанты были протрансформированы геном ингибитора 6-циклин зависимой киназы под контролем 35S-промотора, все трансформанты показали чистый фенотип, характеризуемый зубчатыми листьями, тогда как такой фенотип был зарегистрирован лишь у одного из пяти протрансформированных растений дикого типа. Экспрессия GUS, управляемая промотором 35S, оставалась высокой и стабильной и у следующего поколения линий sgs2 и sgs3, в противоположность вариабильной экспрессии в Т2 популяциях дикого типа. В дальнейшем было показано, что конструкции Т-ДНК фланкированные последовательностями chiMAR вызывают повышение активности -глюкуронидазы в пять раз в случае sgs2 и в 12 для растений sgs3, достигая при этом до 10% от общего растворимого белка, в то время как для дикого типа таких изменений не наблюдалось. Векторы для растительной трансформации содержащие связывающиеся с матриксом элементы применяемые к PTGS-мутантам могут быть ценными, как для высоко производительного исследования фенотипов растений основанных на чужеродных генах, так и для получения чрезвычайно высоких уровней экспрессии. По существу поведение мутантов sgs2 и sgs3, по отношению к проявлению фенотипа и эффективности трансформации, не отличалось от растений дикого вида.

Несмотря на то, что подход «MAR-PTGS» был применен к восьми различным трансгенам, используя MAR-элементы из различных источников и PTGS мутации, влияющих на разные гены, для экстраполяции этих результатов на другие виды растений необходимо провести еще много дополнительных экспериментов. PTGSослабленные индивиды в этих видах могут быть найдены посредством мутационного скрининга или создания с использованием технологий шпилек регулируемых генов, играющих роль в механизме PTGS.

2.4.7 Альтернативные способы снижения вариабельности трансгеннойэкспрессии

Окончательной альтернативой в борьбе с преодолением межиндивидуальной вариабельности экспрессии могло бы стать создание искусственных растительных хромосом (PLACs plant artificial chromosomes) на подобие искусственных хромосом дрожжей (YACs yeast artificial chromosomes).

Обеспечивая определенное хромосомное окружение для гена, клонированного в PLAC, можно увеличить шансы на создание растений с воспроизводимыми уровнями экспрессии гена (Somerville and Somerville 1999). Разъяснение функций растительных центромер это первый шаг к разработке PLACs. В случае модельного растения A. thaliana центромеры уже были картированы (Copenhaver et al. 1998). Однако не надо забывать и о других необходимых для создания функционирующей растительной центромеры факторах, существующих помимо ДНК последовательности. Анализы, основывающиеся на трансмиссии искусственных хромосом, значительно облегчат характеризацию индивидуальных особенностей функциональных составляющих растительных центромер. Такие эксперименты уже были произведены на искусственных хромосомах человека (HACs human artificial chromosomes Grimes et al. 2002). Последующие исследования на PLACs дадут возможность проведения анализов, объясняющих роль длины центромеры, искусственных составляющих и белков, связывающихся с центромерой во время мейоза и митоза (Hall et al. 2004).

Выше был представлен обзор различных стратегий и технологий, применяемых для получения предсказуемых уровней трансгенной экспрессии в растениях, которые или уже используются, или еще только разрабатываются. Не смотря на широкий спектр возможных вариантов, финальная цель, однако, пока все еще не достигнута. Методика получения прогнозируемых уровней экспрессии без сомнения нуждается в усовершенствовании уже используемых технологий, их комбинации или в разработке новых, еще более современных методов.

Необходимо внимательно наблюдать за прогрессом в развитии этого направления для применения полученных результатов в создании векторов и стратегий трансформации. При последующих исследованиях одни технологии могут оказаться привлекательнее других в зависимости от конкретной поставленной цели и задач эксперимента или специфики применения в определенном технологическом производстве. Например, транзиентные экспрессионные системы могут быть улучшены применением вирусных векторов или с помощью вирусных супрессоров сайленсинга генов. Если требуются только несколько трансгенных растений с высоким уровнем экспрессии, может быть рассмотрена трансформация пластид или использование высокопродуктивных кассет для ядерной трансформации. С другой стороны, применение трансформации векторами содержащими MAR-элементы при использовании PTGS мутантов или системы «ампликон плюс» скорее всего окажутся предпочтительнее для высокопроизводительного скрининга фенотипов. Анализируя весь объем представленной информации можно сказать, что на сегодняшний день разработка таких методик идет в одном направлении с самыми актуальными течениями современной науки. Многое в достижении стабильной и предсказуемой экспрессии в растениях уже достигнуто и будущее без сомнения принесет много новых методов дальнейшей оптимизации трансгенной экспрессии для различных областей применения, т.к. на данный момент такая работа идет достаточно активно.

Таким образом, разработка и создание новых методов, позволяющих добиться высокого и стабильного уровня экспрессии у трансгенных растений, сегодня без сомнения является весьма актуальной задачей.

–  –  –

3.1.1 Электрофорез в агарозном геле Буфер 50X TAE (на литр): 242 г Tris, 100 мл 0.5M EDTA (pH 8.0), 57.1 мл ледяной уксусной кислоты.

Электрофорез проводили в 1 – 2 %-ном агарозном геле с использованием буфера 1х TAE с добавлением бромистого этидия в течение 40 - 60 мин при напряжённости электрического поля 10-20 В/см. Концентрацию агарозного геля подбирали ориентируясь на необходимость оптимального разделения фрагментов ДНК. В лунки вносили 3 мкл пробы, предварительно смешивая их с буфером для нанесения проб (0,25% бромфенолового синего, 0,25% ксилолцианола, 30% глицерина) в отношении 5:1. В качестве маркера длин фрагментов ДНК на агарозный гель дополнительно наносили 1kb DNA Ladder Mix (Fermentas) или ДНК бактериофага, порезанную PstI. Визуализацию ДНК проводили с помощью трансиллюминатора и фотографировали в проходящем ультрафиолетовом свете.

3.1.2 Выделение фрагментов ДНК из агарозных гелей

Продукты рестрикции ДНК разделяли методом горизонтального гельэлектрофореза, вырезали из агарозного геля с помощью ультрафиолетовой лампы (=360нм) участок, содержащий интересующий нас фрагмент ДНК, и переносили в эппендорфы. Далее использовался набор для очистки плазмидной ДНК Zymoclean Gel DNA Recovery Kit. Следуя инструкции производителя к агарозному гелю добавляли необходимое количество соответствующего буфера и инкубировали на 55°С до полного растворения агарозы (~15`). Затем раствор переносили на колонку, центрифугировали 30 сек при 12000 об/мин и промывали спиртом. Фрагменты ДНК смывали 50 мкл H2O (3 мин при 12000 об/мин).

3.1.3 Определение концентрации нуклеиновых кислот Концентрацию определяли либо спектрофотометрическим методом при =260 нм на спектрофотометре, либо по силе флуоресценции бромистого этидия в ультрафиолете с использованием метода гель электрофореза при сравнивании с образцами с известной концентрацией 3.1.4 Рестрикция Реакцию рестрикции проводили в соответствующем буферном растворе в 20 мкл, в случае аналитического расщепления, или в 30-50 мкл, для препаративного расщепления.

Реакционная смесь для рестрикции содержала:

-1х буфер, соответствующий выбранным рестриктазам;

-плазмидная ДНК (конечная концентрация 0.02-0.2 мкг/мл);

-1-10 ед. эндонуклеазы рестрикции;

Инкубация проводилась при 37°С в течение 2ч.

3.1.5 Фосфорилирование олигонуклеотидов

Смешивались олигонуклеотиды, примерно по 30пМ, 1/10 объема PNKбуфера (буфер для полинуклеотидкиназы, прямая реакция), 1/10 объема 10 мМ раствора рибоАТФ, 1/10 объема PNK, стерильной водой MilliQ объем доводился до 10-20 мкл. Инкубация проходила при 37°С 1 час и при 70°С 30 мин.

3.1.6 Лигирование

Реакционная смесь для лигирования содержала:

10-50 нг фрагмента ДНК вектора;

50-400 нг фрагмента ДНК вставки;

1х буфер;

2-5 ед ДНК-лигазы бактериофага T4;

1/10 объема 50% ПЭГ – при лигировании «тупых» концов.

Инкубация проходила при комнатной температуре в течение ночи.

3.1.7 Тупление "липких" концов фрагментов плазмидной ДНК 3.1.7.а) с использованием фрагмента Кленова

Реакцию проводили в объеме 15 мкл. Реакционная смесь содержала:

0,5-1 г плазмидной ДНК;

1х буфер;

0,05mM 4 dNTP смеси;

2 ед фрагмента Кленова.

Смесь инкубировали в термостате в течение 20 минут при 37oC. По истечении времени реакции фермент инактивировали нагреванием: смесь выдерживали в течение 15 минут при 75 oC.

3.1.7.б) с использованием T4-ДНК полимеразы

Реакцию проводили в объеме 15 мкл. Реакционная смесь содержала:

0,5-1 мкг плазмидной ДНК;

1х буфер;

0,05mM 4dNTP смеси;

10 ед. T4 ДНК – полимеразы.

Смесь инкубировали в термостате в течении 15 минут при 11 oC. По истечении времени реакции фермент инактивировали нагреванием: смесь выдерживали в течение 15 минут при 75 oC.

3.1.8 Приготовление компетентных клеток

Растворы и питательные среды, применявшиеся для культивирования E.coli и приготовления компетентных клеток:

1. SOB: 2% бакто-триптон, 0.5% дрожжевой экстракт, 10 мМ NaCl,

2.5 мМ KCl, 10 мМ MgCl2, 10 мМ MgSO4. Для агаразированной среды добавляем еще агар 15г/л

2. TB: 250 мМ KCl, 10 мМ MOPS, 15 мМ CaCl2, 55 мМ MnCl2.

Работа с бактериальными клетками проводилась в стерильных условиях. Со стока на чашку с агаризированной средой SOB высевались клетки штамма DII5.

Инкубация проводилась при 37 0С до появления крупных колоний (2-3 мм). На ночь петлей с краев десяти колоний собирались клетки и высевались в 5 мл среды SOB в 50 мл пробирку. Инкубация проводилась при 18 0С на качалке, при 180 об/мин около суток. В ночь рассевались 200 мкл этой суспензии в 250 мл среды SOB, в двухлитровой колбе. Инкубировали при 18 0С на качалке до оптической плотности 0,6-1,0 единиц, при =600нм. После помещали клетки на 10 минут в лед, далее в охлажденный цетрифужный стан и откручивали 10 мин при 2500 об/мин в центрифуге, предварительно охлажденной до 4 0С. Клетки ресуспендировали в 80 мл охлажденного во льду буфера TB и переносили их в две 50ти мл пробирки. Инкубировали 10 мин во льду и откручивали при 2000 об/мин 10 мин. Клетки ресуспендировали в 20 мл буфера TB и, медленно помешивая, добавляли в суспензию ДМСО до 7%. Инкубировали клетки 10 мин, разливали в охлажденные эппендорфы и замораживали в жидком азоте. Хранили готовые компетентные клетки при -700С.

Компетентность клеток оценивали трансформацией плазмидой pBluescript SK с известной концентрации (0,5 нг/мкл). В качестве отрицательного контроля на загрязнение компетентных клеток чужеродной плазмидной ДНК, проводили трансформацию клеток без добавления плазмиды. Компетентность клеток обычно составляла около 1*106 кл/мкг ДНК.

3.1.9 Трансформация клеток E. сoli

1. LB на 1 л: NaCl – 10 г; дрожжевой экстракт – 5 г; бакто-триптон – 10г. Для агаразированной среды добавляем еще агар 15г/л

2. YT (на 1 л): 8 г бакто-триптона, 5 г дрожжевого экстракта, 5 г NaCl.

Использовали компетентные клетоки. Клетки размораживали в ледяной бане. Охлажденную до +4°С ДНК (200 пг-10 нг в объеме 1-20 мкл) добавляли в размороженные клетки и смесь инкубировали во льду в течение 30 мин. Затем пробирки помещали на 30 сек в водяную баню с температурой 42°C или в термостат. После теплового шока клетки быстро переносили в лед, и инкубировали еще в течение 5 мин. После охлаждения аликвоту высевали на чашки с LB-агаром с ампициллином и/или канамицином и/или хлорамфениколом.

Клетки инкубировали в течение 16-18 часов при 370 С.

Перед последним этапом в некоторых случаях к клеткам добавляли 900 мкл среды YT, инкубировали 60 мин при 37°C и только потом высевали на чашки Петри с соответствующим антибиотиком.

При клонировании использовался штамм E.coli DH5альфа.

3.1.10 Выделение плазмидной ДНК методом щелочного лизиса

Растворы:

Раствор 1 (лизирующий):

50 мМ трис рН8; 10 мМ ЭДТА.

Раствор 2 (денатурирующий):

0,2 М гидроксид натрия; 1% додецилсульфат натрия (SDS).

Раствор 3 (солевой):

7,5 М ацетат аммония.

3.1.10.а) Минипрепаративное выделение плазмидной ДНК Выросшую на чашке с ампициллином колонию переносили в 15 мл пробирку с 3 мл среды LB с ампициллином и наращивали в течение 16-18 часов на термостатированной качалке при 370С, 220 об/мин. 2мл среды с клетками центрифугировали 1 мин при 12000 об/мин. Супернатант отбирали водоструйным насосом. Осадок ресуспендировали в 200 мкл раствора 1 и инкубировали при комнатной температуре. Затем добавляли 400 мкл раствора 2 и инкубировали 5мин. при 00С. Далее добавляли предварительно охлажденный 400 мкл 2,8М раствор NH4Ас и инкубировали 5 мин. при 00С. Центрифугировали 10 мин при 12000 об/мин. Супернатант переносили в новую пробирку, добавляли 0,6V изопропанола, перемешивали и оставляли в течение 10 мин. при +4 0С.

Центрифугировали в течение 10 мин при 12000 об/мин, тщательно удаляли изопропанол при помощи водоструйного насоса. Осадок промывали 70% этанолом, центрифугировали в течение 5 минут. Полученный осадок высушивали и растворяли в 20-30 мкл деионизированной воды.

3.1.10.б) Максипрепаративное выделение плазмидной ДНК Культуру клеток наращивали в среде LB с ампицилином объемом 50 мл в 250 мл колбах 16-18 часов при 37 oC при скорости помешивания 220 об/мин.

После наращивания клетки осаждали в 50 мл пробирках для центрифугирования 5 минут (6000 об/мин). Супернатант отбирали водоструйным насосом. К полученному осадку клеток последовательно добавляли растворы 1, 2, 3 в пропорции 1:1:1. 1-ый раствор добавляли охлажденным (4 мл), смесь ресуспендировали. После добавления 2-го раствора (4 мл), содержимое пробирок мешали легким переворачиванием и держали во льду не более 5 минут. 3-ий раствор (4мл) добавляли охлажденным, мешали переворачиванием. После добавления 3-го раствора пробирки для центрифугирования ставили в ледяную баню, держали 5 минут, центрифугировали 20 минут (6000 об/мин) при 4 oC.

После центрифугирования супернатант отбирали в новые пробирки для центрифугирования объемом 50 мл.

К отобранному супернатанту добавляли 0,6 объема изопропанола, перемешивали переворачиванием, выдерживали 10-15 минут при 4 oC и центрифугировали 15-20 минут (6000 об/мин) при 4 oC. После центрифугирования тщательно удаляли изопропанол, осадок высушивали. К высушенному осадку добавляли 1 мл охлажденного 2M NH4Ас, держали в ледяной бане 5 минут и тщательно ресуспендировали. Полученную суспензию переносили в чистые пробирки объемом 1,5 мл и центрифугировали 5-7 минут (12000 об/мин). Супернатант переносили в новые чистые объемом 2 мл, o добавляли 0,6 объема изопропанола, выдерживали 10 минут при 4 Cи центрифугировали 10 минут (12000 об/мин). После центрифугирования изопропанол тщательно отбирали. Осадок ДНК промывали 200 мкл 70% этанола, центрифугировали 5 минут. Полученный осадок высушивали и растворяли в 100 мкл деионизованной воды.

3.1.11 Переосаждение ДНК

К раствору, содержащему ДНК, добавляли 1/10 объема 3 М ацетата натрия, перемешивали, добавляли 3 объема 96% этанола (или 1 объем изопропанола), перемешивали еще раз и выдерживали при -70 oC в течение 20 минут. По истечении нужного времени раствор центрифугировали 20 минут (12000 об/мин).

Супернатант удаляли. Осадок промывали 70% этанолом, центрифугировали 5 минут. Полученный осадок высушивали и растворяли в необходимом количестве деионизованной воды.

3.1.12 Культивирование бактерий для выделения плазмидной ДНК

С чашки с бакто-агаром, в который был добавлен ампициллин или канамицин и/или хлорамфеникол, в стерильных условиях снимали 1 колонию и помещали ее в пробирку на 15 мл с 3 мл среды LB, в которую также был добавлен ампициллин, канамицин и/или хлорамфеникол. Культивировали в течение ночи при 37С на качалке (220 об/мин).

3.1.13 Проведение ПЦР-скрининга

Реакционные смеси (20 мкл) содержали 1 x SuperTaq буфер, 0.2 мМ нуклеозидтрифосфатов, 1 мкМ каждого из праймеров, 1 ед активности Taq полимеразы.

Перед началом реакции смесь прогревали в течение 5 мин при 96 С. Цикл амплификации включал в себя денатурацию ДНК при 92 С (30 сек), отжиг при 35С (30 сек), элонгацию при 74С. Всего проводили 20 циклов на приборе «Mastercycler personal» («Eppendorf»).

3.1.14 Трансформация A. tumefaciens

LB на 1 л: NaCl – 10 г; дрожжевой экстракт – 5 г; бакто-триптон – 10г.

Для агаразированной среды добавляем еще агар 15г/л Для трансформации применяли обезоруженный супервирулентный штамм A. tumefaciens CBE21 (Revenkova et al., 1993)

1) одной колонией A. tumefaciens с агаризованной LB инокулировали жидкую среду LB (2 мл). Инкубировали при 37С 12-16 часов на качалке (150 об/мин);

2) отбирали 50 мкл клеточной суспензии и ею инокулировали свежую жидкую LB из расчета 1,5 мл на 1 трансформацию, инкубировали при 37 С до оптической плотности А600 =0,6 на качалке;

3) 1,5 мл клеточной суспензии отбирали в новый эппендорф и осаждали клетки центрифугированием 6 мин 6500 об/мин;

4) к осадку добавляли 500 мкл охлажденного 0,025М CaCl2, ресуспендировали и инкубировали на льду в течение 20 мин;

5) осаждали клетки путем центрифугирования 4 мин при 6500 об./мин, к осадку добавляли 200 мкл 0,025М ледяного CaCl2, ресуспендировали;

6) к клеточной суспензии добавляли 10-50 нг плазмидной ДНК или объем лигазной смеси, содержащий 50-100 нг ДНК, инкубировали на льду в течение 60 мин;

7) шокировали клетки, поместив пробирки на 60-120 секунд в водяную баню, нагретую до 32С, после чего сразу же помещали эппендорфы на лед на 20 мин;

8) добавляли 800 мкл жидкой среды LB и инкубировали 3-4 часа при 37С на качалке;

9) осаждали клетки путем центрифугирования 6 мин при 6500 об./мин;

10) осадок суспендировали в 50 мкл среды LB и растирали стеклянным шпателем на чашке Петри с агаризованной LB, содержащей соответствующий антибиотик;

11) инкубировали чашки 16 - 18 часов при 37С, затем оценивали количество колоний-трансформантов.

–  –  –

3.2.1 Подготовка маточных растений МS (Murashige и Skoog, 1962): 170 мг/л KH2PO4, 1,9 г/л KNO3, 180,5 мг/л MgSO4, 1,65 мг/л NH4NO3, 25 мкг/л CoCl2x6H2O, 25 мкг/л CuS04.5H2O, 6,2 мг/л Н3ВО3, 0,83 мг/л KI, 16,9 мг/л MnSO4.H2O, 0,25 мг/л Na2MoO4.2H2O, 8,6 мг/л ZnS04x7H2O, 332 мг/л CaCl2, 36,7 мг/л FeNaEDTA, 100 мг/л инозитола, 30 г/л сахарозы, 7 г/л агара.

В качестве маточных использовались растения Nicotiniana tabacum сорта Petite Havana SR1 культуры in vitro, находящиеся на среде MS с добавлением витаминов MS, в соответствующем количестве, с содержанием сахарозы 10 % и агара 0.8 %. Растения культивировались при 230С, световом режиме дня 16 ч/8 ч (день/ночь), освещенности – 3000-3500 люкс и подвергались пересадки один раз в два месяца. Для эксперимента использовались растения на вторую-третью неделю после очередного пассажа.

Стерильные растения выращивали на среде MS (Murashige и Skoog, 1962) при следующих условиях: фотопериод – 16/8 часов, температура – 23-250С,.

3.2.2 Сбор и подготовка листьев Сбор листьев с маточных растений табака двух-трех недельного возраста, содержащихся в культуре in vitro, происходил непосредственно перед постановкой генетической трансформации. Срезали молодые, полностью развернувшиеся листья. Чтобы уменьшить усыхание листьев в процессе последующих операций, их содержат в закрытых чашках Петри с небольшим количеством (20 мл) дистиллированной воды. На одну чашку приходится по 20-25 нарезанных фрагментов листа, приметным размером 0.5х2 см.

3.2.3 Трансформация табака (по методу Horch R.B. (1985) с изменениями)

1. Инокулировать 50 мл питательной среды YEP (Sp 50, Rif 50) агробактериями CBE21 и растить в течение ночи, при 28 С.

2. Бактерии осадить центрифугированием, 6 мин, 4300 об/мин.

3. К осадку добавить 40 мл MS. Перемешать встряхиванием флакона.

Открутить при тех же условиях.

4. Промыть таким образом несколько раз, до полного удаления среды YEP.

5. К осадку добавить 50 мл MS и суспендировать. Разлить в два стакана и довести объем в каждом до 75 мл.

6. Нарезать эксплант в чашке Петри с небольшим слоем MS на дне.

7. В стакан с агробактерией пинцетом перенести нарезанные листья, инкубируем 20-30 минут на столе.

8. Перенести экспланты на чашку Петри с фильтровальной бумагой и подсушить около пяти минут.

9. Перенести экспланты на агаризованную среду MS (сахароза 30 г/л, BAP 1мг/л, ИУК 0,1 мг/л), покрытую фильтровальной бумагой. Культивировать с агробактерией три дня.

10. Экспланты промыть с MS содержащей 500мг/л цефотаксима.

11. Подсушить на стерильной фильтровальной бумаге.

12. Переложить на среду MS (сахароза 30 г/л, BAP 1мг/л, ИУК 0,1 мг/л, 500мг/л цефотаксима + селективный антибиотик)

3.2.4 Селекция трансгенной ткани, отбор трансформантов иэлиминация агробактерий

Экспланты после инокуляции и кокультивации с агробактериями раскладывают в чашки Петри на поверхность среды MS для регенерации. Чашки заматывают парафильмом и инкубируют в термостате в темноте при температуре 23-250С. Через три дня экспланты пререносят на среду для регенерации дополненную антибиотиками цефотоксимом 500 мг/л и канамицином 100 мг/л.

Цефотоксим используют для элиминации остатков агробактерии на эксплантах.

Канамицин выступает в роли селективного агента, поскольку в векторных конструкциях в качестве селективного маркера используется ген неомицинфосфотрансферазы nptII.

3.2.5 Мультипликация и укоренение трансформантов

Стерильные растения выращивали на среде MS при следующих условиях:

фотопериод – 16/8 часов, температура – 23-250С, освещенность – 3000-3500 люкс.

В процессе прересадок постепенно снижали содержание гормонов, уже через два месяца концентрацию БАП уменьшали до 0.3 мг/л, а ИУК убирали полностью, а потом убирали полностью. Концентрацию цефотоксима изменяют в течение пассажей: с каждым месячным пассажем уровень снижают на 100 мг/л от исходных 500 мг/л до конечных 0 мг/л. Побеги размером один-два сантиметра помещали уже на полностью безгормональную среду. Для укоренения экспланты переносились на среду MS со сниженным содержанием сахарозы, постепенно доводя ее концентрацию до 10 мг/л. При последнем пассаже использовалась среда MS, свободная от антибиотиков. Укорененные растения подвергались предтепличной адаптации и высаживались в тепличный грунт, состоящий из смеси торфа и песка в соотношении 1:1. В дальнейшем они культивировались в условиях зимней теплицы при температуре 20-25 0С и естественном освещении с дополнительной подсветкой в ночные часы.

3.2.6 Выделение геномной ДНК из растений (с SDS) Буфер: 100mM ТрисHCl, pH 8.0, 500mM NaCl, 50M ЭДТА, pH 8.0, 0.7mM 2меркаптоэтанол.

–  –  –

3. Добавить 250 мкл 10% SDS и тщательно ресуспендировать;

4. Отцентрифугировать при максимальных оборотах 10 мин;

5. Надосадок перенести в новый эппендорф;

6. Добавить 625 мкл 5M KAc, тщательно перемешать и перенести на лед на полчаса;

7. Отцентрифугировать при максимальных оборотах 10 мин;

8. Перенести по 900 мкл в две пробирки на 1,5 мл и добавить в каждую по 500 мкл изопропанола;

9. Тщательно перемешать (до появления осадка) и центрифугировать при максимальных оборотах 10 мин;

10. Осадок промыть 70% этанолом и открутить пять минут;

11. Осадок подсушить и растворить в 100 мкл TE буфера или в дистиллированной воде до полного растворения.

12. Для экстракции геномной ДНК использовался растительный материал in vivo. Для анализа с тепличных растений срезался третий лист побега.

3.2.7 Экстракция тотального белка растений Буферы для выделения белка 1: 50mM NaPO4 pH 7.0, 10mM EDTA, 0.1% тритон Х -100, 0.1% саркозил, mM -меркаптоэтанол 2: 30mM TrisHCl, pH 8.0; 10mM EDTA, pH 8.0; 10 mM -меркаптоэтанол;

10% глицерин Для экстракции тотального белка из трансгенных растений табака были использованы листовые пластинки, полученные с тепличных растений.

Замороженный в жидком азоте растительный материал трансгенных и контрольных линий (200 мг) растирали в порошок при помощи ступки и пестика, и затем экстрагировали в буфере. Белки экстрагировали в течение 20 минут при комнатной температуре, предварительно тщательно перемешав суспензию на вортексе, гомогенат центрифугировали при 10000 g 15 минут при комнатной температуре, супернатант отбирали и использовали для дальнейшего анализа.

3.2.8 Флуоресцентный анализ активности гена gfp Флуоресцентный анализ активности гена gfp осуществляли с помощью флуоресцентного микроскопа ICM 405 фирмы Opton (Германия) со светофильтрами 450–490 нм (возбуждение флуоресценции GFP) и 515–530 нм (эмиссия флуоресценции GFP).

3.2.9 Определение количества GFP методом иммуноферментного анализа (ELISA) Первичные антитела –кроличьи антитела TaqGFP (Евроген) Вторичные антитела – козьи антикроличьи антитела, коньюгированные со щелочной фосфатазой.

PBS: 137 mM NaCl, 2,7 mM KCl, 10 mM Na2HPO4, 1,76 mM KH2PO4, pH 7,4 Промывочный буфер: PBS, 0.05% Tween 20 Блокировочный буфер: PBS, 0.05% Tween 20, 2% БСА

–  –  –

4. Промыть четыре раза по три минуты в 200 мкл промывочного буфера;

Блокировать плашку один час 370С 600 об/мин (200 мкл 5.

блокировочного буфера);

6. В блокировочном буфере развести антитела 1:5000. Все дейсвия с антителами проводятся на льду;

7. Удалить блокировочный буфер и добавить первичные антитела.

Запечатать плашку парафильмом и оставить на ночь на +40С;

8. Удалить первичные антитела и промыть четыре раза по три минуты в 200 мкл промывочного буфера;

9. Приготовить вторичные антитела в промывочном буфере 1:5000.

Добавить их в лунки и инкубировать один час 370С 600 об/мин;

10. Удалить вторичные антитела. Промыть четыре раза по три минуты в 200 мкл промывочного буфера;

11. Добавить субстрат и ждать развития окраски;

12. При необходимости остановить реакцию 50 мкл 2N NaOH;

13. Читать на спектрофотометре при 405 нм.

3.2.10 Гистохимический анализ GUS-активности Гистохимическое определение GUS активности проводили по методике Jefferson (1987) с использованием 5-бром-4-хлор-3-индолилглюкуронида (Х-Gluc, Sigma). Для этого листовую ткань (с нанесенными насечками, либо без) помещали в буфер, содержащий 50 мM NaH2PO4, pH 7,0, 10мM Na2ЭДТА, 0,1% тритон Xмг/л Х-Gluc, инкубировали в течение 2-6 часов при 37 С. После чего несколько раз промывали 50% этанолом и хранили окрашенные ткани при 4 С в 70% этаноле.

3.2.11 Флюориметрический анализ GUS-активности Был получен белковый экстракт каждого из растений плюс отрицательный контроль (нетрансгенное растение табака).

1. Для каждого образца предварительно инкубировать 500 мкл буфера в котором экстрагировали GUS с 1mM MUG при 370С.

2. Добавить 20 мкл экстракта ткани в реакционную смесь, перемешать, инкубировать 10 мин.

–  –  –

4. Флюориметр откалибровать по свежеприготовленным стандартным растворам 4-MU в буфере для экстракции GUS с добавлением 0.2M Na2CO3 в соотношении 1:9.

Измерение проводилось при использовании реактива 4-MUG (4метилумбеллиферилглюкоронида), который при расщеплении -глюкуронидазой до 4-MU (4-метилумбеллиферона) имеет оптимумы возбуждения при 365 нм и излучения при 455 нм.

3.2.12 Определение концентрации общего белка

–  –  –

2. Добавить 0.5мл реагента Coomassie G250;

3. Перемешать и ждать развития окраски (от 5 мин, но не больше 30 мин);

4. Измерить оптическую плотность при длине волны 595 (в 1ml кювете);

5. Рассчитать концентрацию белка по калибровочной кривой построенной по БСА (бычий сывороточный альбумин)

2) С использованием набора «Bio-Rad Protein Assay Kit I #500-0002»

–  –  –

VirB1 GGCTACATCGAAGATCGTATGAATG

VirB2 GACTATAGCGATGGTTACGATGTTGAC

NOS CGCGGGTTTCTGGAGTTTAATGAGCTAAG

nptII-2 GCATGCGCGCCTTGAGCCTGG

CaMV35S-R TGAATCTTTTGACTGCATCTTTAACCTTCTT

nptII-F ACGACGGGCGTTCCTTGCG

Mar 2-1 CATAGTGTTACCATCAACCACCTTAACTTC

Mar 2-2 TCCTGTCACCGGATGTGTTTTCC Mar 3-1 TCATAGTGTTACCATCAACCACCTTAACTtc Mar 3-2 TTCCGCAAAAATCACCAGTCTCTCTCTAC Стандартные праймеры GUSA1/GUSA2 Для поднятия терминаторов Upstreem праймеры 1TUpDir ATGACCCCATAATACTTTGTGG 1TUpRev CTACGTTTGGGATACCCTCT 2TUpDir TGCTGCGGACAGAGTCTTGA 2TUpRev GACCCGAGTCCGTCAAGTAA 4TUpDir GCCGTTTTGGGCGGAAACGC 4TUpRev ATGACAGGCCGTTCACATTGTC Внутренние праймеры araterm1Dir CTGGCGCCGTTGACCCA araterm1Rev ATCCCGGGGTTGTATTGGA araterm2Dir AAGCATGCCCTGACATTATC araterm2Rev ATCCGCGGGACAATGGTG araterm4Dir AACCCGGGGTCTGTGCC araterm4Rev GAACTAGTGGTATAGAGAAAG Олигонуклеотиды для полилинкера PolyH1,

GGCCGCATGGCGCCTCCCGGGTACTAGTCAAGCTTGCTCGAGTCTGCAGAGA

CGTCAGCTAGCTCCGCGGAGCATGCAGC

PolyH2,

CGTACCGCGGAGGGCCCATGATCAGTTCGAACGAGCTCAGACGTCTCTGCAG

TCGATCGAGGCGCCTCGTACGTCGCCGG.

Олигонуклеотиды для 35S минимального 35SminPA1

GGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGC

TGGACGT

35SminPA2

CCAGCGTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTCTT

GCCTGCA

Праймеры на промоторы и репортерные гены 35SpaDir AGCTGCAGGTCCCCAGAT 35SpaRev TAGACGTCCGTGTTCTCTC RubhxDir GGAAGCTTGCAAGTAATAАAC RubhxRev TACTCGAGTGCTGAAAACC GUSanDir ATGACGTCATGTTACGTCCT

GUSRev TTGCTAGCGATCTAGTAACATA

GFPerxpDir TACTCGAGATGAAGACTAATC GFPerxpRev TTCTGCAGGATCTAGTAACATA ElipDir TTCTGCAGCGGAGCTCCA ElipRev TAGACGTCTATTTTTCTTCTAC

–  –  –



Pages:     | 1 || 3 | 4 |   ...   | 5 |

Похожие работы:

«Черкасова Анна Владимировна НОВЫЕ КАРОТИНСОДЕРЖАЩИЕ БАД: ПОЛУЧЕНИЕ, СВОЙСТВА И ПРИМЕНЕНИЕ ДЛЯ ОБОГАЩЕНИЯ МОЛОЧНЫХ ПРОДУКТОВ Специальность: 05.18.07– Биотехнология пищевых продуктов и биологических активных веществ Диссертация на соискание ученой степени кандидата технических наук Научный руководитель: доктор технических наук,...»

«Палаткин Илья Владимирович Подготовка студентов вуза к здоровьесберегающей деятельности 13.00.01 общая педагогика, история педагогики и образования Диссертация на соискание ученой степени кандидата педагогических наук Научные руководители: доктор биологических наук, профессор,...»

«КУЖУГЕТ ЕЛЕНА КРАССОВНА «Хозяйственно-биологические особенности крупного рогатого скота, разводимого в разных природно-климатических зонах Республики Тыва» 06.02.10. Частная зоотехния, технология производства продуктов животноводства Диссертация на соискание ученой степени кандидата сельскохозяйственных наук Научный...»

«Горовой Александр Иванович БИОЛОГИЧЕСКИ АКТИВНЫЕ ВЕЩЕСТВА ДРЕВЕСНОЙ ЗЕЛЕНИ И ШИШЕК PINUS KORAIENSIS (ПОЛУЧЕНИЕ, СОСТАВ, ИСПОЛЬЗОВАНИЕ) 03.02.14 – биологические ресурсы Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, профессор Тагильцев Ю. Г. Хабаровск – 2015 СОДЕРЖАНИЕ стр Введение.. 4 Глава 1 Обзор...»

«ПИМЕНОВА ЕКАТЕРИНА ВЛАДИМИРОВНА РАЗРАБОТКА МЕТОДА ОЦЕНКИ ЦИТОТОКСИЧНОСТИ АНТИГЕНОВ ВОЗБУДИТЕЛЯ МЕЛИОИДОЗА IN VITRO НА МОДЕЛИ ПЕРЕВИВАЕМЫХ КЛЕТОЧНЫХ КУЛЬТУР 03.02.03 – микробиология Диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор...»

«АРУТЮНЯН ЛУСИНЕ ЛЕВОНОВНА МНОГОУРОВНЕВЫЙ АНАЛИЗ СОСТОЯНИЯ КОРНЕОСКЛЕРАЛЬНОЙ ОБОЛОЧКИ ГЛАЗА В РЕАЛИЗАЦИИ НОВЫХ ПОДХОДОВ К ДИАГНОСТИКЕ И ЛЕЧЕНИЮ ПЕРВИЧНОЙ ОТКРЫТОУГОЛЬНОЙ ГЛАУКОМЫ 14. 01. 07 глазные болезни Диссертацияна соискание ученой степени доктора медицинских наук Научные консультанты:...»

«КАРПЕНКО Анна Юрьевна Изменение трансинтестинальной проницаемости и показателей врожденного иммунитета у онкологических больных в периоперационном периоде 14.03.09 – клиническая иммунология и аллергология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор медицинских наук...»

«Платонова Ирина Александровна ПОСТПИРОГЕННАЯ ТРАНСФОРМАЦИЯ НАДЗЕМНОЙ ФИТОМАССЫ В СОСНЯКАХ СЕЛЕНГИНСКОГО СРЕДНЕГОРЬЯ Специальность 06.03.02 – Лесоведение и лесоводство, лесоустройство и лесная таксация ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный руководитель: д.б.н., с.н.с. Г.А. Иванова Красноярск – 2015...»

«Васильева Ольга Валерьевна Ангиогенные факторы в коже человека в возрастном аспекте 03.03.04 – клеточная биология, цитология, гистология Диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель: Доктор медицинских наук профессор Гунин А.Г. Чебоксары – 2015 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ ГЛАВА 1....»

«САФИНА ЛЕЙСЭН ФАРИТОВНА Анафилактический шок на ужаления перепончатокрылыми насекомыми (частота встречаемости, иммунодиагностика, прогнозирование) 14.03.09 – клиническая иммунология, аллергология Диссертация на соискание ученой степени кандидата медицинских наук Научный...»

«БАБЕШКО Кирилл Владимирович ЭКОЛОГИЧЕСКИЕ ПРЕДПОЧТЕНИЯ СФАГНОБИОНТНЫХ РАКОВИННЫХ АМЕБ И ИХ ИСПОЛЬЗОВАНИЕ ДЛЯ РЕКОНСТРУКЦИИ ГИДРОЛОГИЧЕСКОГО РЕЖИМА БОЛОТ В ГОЛОЦЕНЕ Специальность 03.02.08 – экология (биология) диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: кандидат биологических наук Цыганов...»

«Сухарьков Андрей Юрьевич РАЗРАБОТКА МЕТОДОВ ОЦЕНКИ ОРАЛЬНОЙ АНТИРАБИЧЕСКОЙ ВАКЦИНАЦИИ ЖИВОТНЫХ 03.02.02 «Вирусология» Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: кандидат ветеринарных наук, Метлин Артем Евгеньевич Владимир 2014 ОГЛАВЛЕНИЕ 1 ВВЕДЕНИЕ 2 ОБЗОР ЛИТЕРАТУРЫ 2.1 Характеристика возбудителя бешенства 2.2 Эпизоотологические...»

«Ульянова Онега Владимировна МЕТОДОЛОГИЯ ПОВЫШЕНИЯ БЕЗОПАСНОСТИ БАКТЕРИАЛЬНЫХ ВАКЦИН НА МОДЕЛИ ВАКЦИННЫХ ШТАММОВ BRUCELLA ABORTUS 19 BA, FRANCISELLA TULARENSIS 15 НИИЭГ, YERSINIA PESTIS EV НИИЭГ 03.02.03 – микробиология Диссертация на соискание ученой степени доктора биологических наук Научный консультант:...»

«Кузнецова Наталья Владимировна СОВРЕМЕННОЕ ГИДРОБИОЛОГИЧЕСКОЕ СОСТОЯНИЕ РЕКИ ЯХРОМА КАК МОДЕЛЬНОЙ МАЛОЙ РЕКИ ПОДМОСКОВЬЯ 03.02.10 – гидробиология Диссертация на соискание ученой степени кандидата биологических наук...»

«ШАЙКЕВИЧ Елена Владимировна ГЕНЕТИЧЕСКАЯ ИДЕНТИФИКАЦИЯ БЛИЗКОРОДСТВЕННЫХ ВИДОВ НАСЕКОМЫХ И РОЛЬ СИМБИОНТОВ В ИХ ЭВОЛЮЦИИ (НА ПРИМЕРЕ КОМПЛЕКСА ВИДОВ Culex pipiens И Adalia spp). 03.02.07 – генетика ДИССЕРТАЦИЯ на соискание ученой степени доктора биологических наук Научный консультант член-корр. РАН, доктор биологических наук, профессор Захаров-Гезехус Илья...»

«Анохина Елена Николаевна ПОЛИМОРФИЗМЫ ГЕНОВ ПРОИ ПРОТИВОВОСПАЛИТЕЛЬНЫХ ЦИТОКИНОВ, МУТАЦИИ ГЕНОВ BRCA1/2 ПРИ ЗЛОКАЧЕСТВЕННЫХ НОВООБРАЗОВАНИЯХ ОРГАНОВ ЖЕНСКОЙ РЕПРОДУКТИВНОЙ СИСТЕМЫ 14.03.09 – клиническая иммунология, аллергология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук Тугуз А.Р. Майкоп 2015 Оглавление Список сокращений.. 3 Введение.. 5 Глава I....»

«Ядрихинская Варвара Константиновна ЭКОЛОГИЧЕСКИЕ ОСОБЕННОСТИ РАСПРОСТРАНЕНИЯ ОСТРЫХ КИШЕЧНЫХ ИНФЕКЦИЙ В Г. ЯКУТСКЕ И РЕСПУБЛИКЕ САХА (ЯКУТИЯ) 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель кандидат биологических наук, доцент М.В. Щелчкова Якутск 2015...»

«Мамалова Хадижат Эдильсултановна БИОЛОГИЧЕСКАЯ И ХОЗЯЙСТВЕННАЯ ОЦЕНКА ПЕРСПЕКТИВНЫХ СОРТОВ ЯБЛОНИ В УСЛОВИЯХ ЧЕЧЕНСКОЙ РЕСПУБЛИКИ специальность: 06.01.08 – Плодоводство, виноградарство диссертация на соискание ученой степени кандидата сельскохозяйственных наук Научный руководитель, доктор сельскохозяйственных наук, доцент Заремук Римма...»

«Кириллин Егор Владимирович ЭКОЛОГИЯ ОВЦЕБЫКА (OVIBOS MOSCHATUS ZIMMERMANN, 1780) В ТУНДРОВОЙ ЗОНЕ ЯКУТИИ 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: д. б. н., профессор Мордосов И. И. Якутск – 2015 Содержание Введение.. Глава 1. Краткая физико-географическая...»

«Жукова Дарья Григорьевна ДИАГНОСТИКА И ПРОГНОЗИРОВАНИЕ РЕАКЦИЙ ГИПЕРЧУВСТВИТЕЛЬНОСТИ К ЛЕКАРСТВЕННЫМ ПРЕПАРАТАМ У БОЛЬНЫХ В ПЕРИОПЕРАЦИОННОМ ПЕРИОДЕ В УСЛОВИЯХ МНОГОПРОФИЛЬНОГО СТАЦИОНАРА 14.03.09 клиническая иммунология, аллергология Диссертация на соискание ученой степени кандидата медицинских наук Научные руководители: доктор...»







 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.