WWW.KONF.X-PDF.RU
- , ,
 


Pages:     | 1 |   ...   | 6 | 7 ||

: ...

-- [ 8 ] --

416. Webster LT. Microbic Virulence and Host Susceptibility in ParatyphoidEnteritidis Infection of White Mice : Vii. The Effect of Selective Breeding on Host Resistance. Further Studies. The Journal of experimental medicine 1925, 42(1): 1-7.

417. Weinberg HS, Korol AB, Kirzhner VM, Avivi A, Fahima T, Nevo E, et al.

Very high mutation rate in offspring of Chernobyl accident liquidators.

Proceedings Biological sciences / The Royal Society 2001, 268(1471):

1001-5.

418. Welbourn S. HCV NS2/3 Protease. In: Tan SL, SourceHepatitis C Viruses:

Genomes and Molecular Biology. Horizon Bioscience 2006.

419. Wertheim JO, Worobey M. Dating the age of the SIV lineages that gave rise to HIV-1 and HIV-2. PLoS computational biology 2009, 5(5): e1000377.

420. Willems P, Claes K, Baeyens A, Vandersickel V, Werbrouck J, De Ruyck K, et al. Polymorphisms in nonhomologous end-joining genes associated with breast cancer risk and chromosomal radiosensitivity. Genes, chromosomes & cancer 2008, 47(2): 137-48.

421. Williams KM, Hakim FT, Gress RE. T cell immune reconstitution following lymphodepletion. Seminars in immunology 2007, 19(5): 318-30.

422. Winkler C, Modi W, Smith MW, Nelson GW, Wu X, Carrington M, et al.

Genetic restriction of AIDS pathogenesis by an SDF-1 chemokine gene variant. ALIVE Study, Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC). Science 1998, 279(5349): 389-93.

423. Xavier RJ, Rioux JD. Genome-wide association studies: a new window into immune-mediated diseases. Nature reviews Immunology 2008, 8(8): 631-43.

424. Yeager M, Orr N, Hayes RB, Jacobs KB, Kraft P, Wacholder S, et al.

Genome-wide association study of prostate cancer identifies a second risk locus at 8q24. Nature genetics 2007, 39(5): 645-9.

425. Yoon HE, Yang CW. Established and newly proposed mechanisms of chronic cyclosporine nephropathy. The Korean journal of internal medicine 2009, 24(2): 81-92.

426. Yoshimura T, Robinson EA, Tanaka S, Appella E, Leonard EJ. Purification and amino acid analysis of two human monocyte chemoattractants produced by phytohemagglutinin-stimulated human blood mononuclear leukocytes.

Journal of immunology 1989, 142(6): 1956-62.

427. Youle M, Wainberg MA. Pre-exposure chemoprophylaxis (PREP) as an HIV prevention strategy. Journal of the International Association of Physicians in AIDS Care 2003, 2(3): 102-5.

428. Zak DE, Aderem A. Overcoming limitations in the systems vaccinology approach: a pathway for accelerated HIV vaccine development. Current opinion in HIV and AIDS 2012, 7(1): 58-63.

429. Zhang XM, Wang HY, Luo YY, Ji LN. HLA-DQ, DR allele polymorphism of type 1 diabetes in the Chinese population: a meta-analysis. Chinese medical journal 2009, 122(8): 980-6.

430. Zhernakova A, van Diemen CC, Wijmenga C. Detecting shared pathogenesis from the shared genetics of immune-related diseases. Nature reviews Genetics 2009, 10(1): 43-55.

431. Zhu T, Korber BT, Nahmias AJ, Hooper E, Sharp PM, Ho DD. An African HIV-1 sequence from 1959 and implications for the origin of the epidemic.

Nature 1998, 391(6667): 594-7.

432. Zimmermann JS, Kumpf L, Kimmig B. Variability of individual normal tissue radiation sensitivity. An international empirical evaluation of endogenous and exogenous response modifiers. Strahlentherapie und Onkologie: Organ der Deutschen Rontgengesellschaft [et al] 1998, 174 Suppl 3: 16-9.

433. Zinkernagel RM, Doherty PC. Characteristics of the interaction in vitro between cytotoxic thymus-derived lymphocytes and target monolayers infected with lymphocytic choriomeningitis virus. Scandinavian journal of immunology 1974, 3(3): 287-94.

434. Zlotnik A, Yoshie O. Chemokines: a new classification system and their role in immunity. Immunity 2000, 12(2): 121-7.

435. Zwolinska K, Knysz B, Rybka K, Pazgan-Simon M, Gasiorowski J, Sobczynski M, et al. Protective effect of CCR5-Delta32 against HIV infection by the heterosexual mode of transmission in a Polish population.

AIDS research and human retroviruses 2013, 29(1): 54-60.

1

1. rs333, rs1799864, rs1801157 ( - ).

rs333 (I) 5'-TCCATACAGTCAGTATCAATTCTGGA-3' rs333 (N) 5'-TGCAGCTCTCATTTTCCATACATTA-3' rs333 5'-AGGATTCCCGAGTAGCAGATGAC-3' rs1799864 (G) 5'-TTGTGGGCAACATGCTGGTCG-3' rs1799864 (A) 5'-TTGTGGGCAACATGCTGGTCA-3' rs1799864 5'-GTGAGCCCACAATGGGAGAGTAA-3' rs1801157 (G) 5'-TCTCCATCCACATGGGAGCCG-3' rs1801157 (A) 5'-TCTCCATCCACATGGGAGCCA-3' rs1801157 5'-GATGAGGGCTGGGTCTCACTCTG-3' rs333 (BHQ1)-TTGGGGCTGGTCC(FdT)GCCGCTGCTTG-(P) rs1799864 (BHQ1)-TGCTCAACCTGGCCA(FdT)CTCTGATCTGC-(P) rs1801157 (BHQ1)-GCTCAGGGTAGCCC(FdT)GCTGCCCTCCC-(P)

   

2 , 5UTR HCV

:

- pEGFP, CMV- - 5'UTR HCV 1b - Xba I/Nhe I BspE I-Age I

- , EGFP Ŗ /-

TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGG

AGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAA

CGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCA

ATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCC

ACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTC

AATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGG

ACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTG

ATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGG

GATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAA

AATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAA

TGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGT

GAACCGTCAGATCCgctagaGCCAGCCCCCGATTGGGGGCGACACTCCACCATA

GATCACTCCCCTGTGAGGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATG

GCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCA

TAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCC

TTTCTTGGATCAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGA

CTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAG

GGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACCtccggtcgccaccAT

GGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG

CTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAG

GGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCA

AGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCA

GTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCC

GCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACG

GCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGA

ACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGG

GGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGA

CAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGA

GGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGC

GACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCC

TGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGT

GACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA



Pages:     | 1 |   ...   | 6 | 7 ||

:

06.02.10 , ר ...

- 03.02.02 : , 2015 1 2 2.1 ...

25.00.28 , 2015 1....

03.02.02 : , 2015 1 2 2.1 ...

- 06.02.01 , , : ...

: 03.02.08 ( ) : ...

06.03.02 , : ..., ... .. 2015...







 
<<     |    
2016 www.konf.x-pdf.ru - - , ,

, .
, , , , 1-2 .