WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 


Pages:     | 1 |   ...   | 2 | 3 || 5 | 6 |   ...   | 8 |

«ИММУНОГЕНОТИПИРОВАНИЕ И ГЕНОДИАГНОСТИКА В БИОМЕДИЦИНЕ: ФУНДАМЕНТАЛЬНЫЕ И ПРИКЛАДНЫЕ АСПЕКТЫ «...»

-- [ Страница 4 ] --
rs9642880 GCGCATTTGAAGAAATCTCACTCATCTT rs13281615 AGAGGTGGTTGTGTTTTCGGTGCTGG rs1447295 ACATTCATTTGTTGAGTTGCACGCCAG 2.6.3 Секвенирование Дальнейшая подготовка продукта для проведения реакции секвенирования включала химическую денатурацию матрицы с помощью денатурирующего буфера TSR (Template Suppression Reagent, Applied Biosystems, США) в соответствии с протоколом, рекомендованным производителем.

Секвенирование проводили с помощью автоматического секвенатора ABI PRISM® 310 Genetic Analyzer (Applied Biosystems, США) согласно рекомендациям производителя.

2.7 СТАТИСТИЧЕСКАЯ ОБРАБОТКА РЕЗУЛЬТАТОВ

Частоту аллелей вычисляли по формуле:

f = n/2N где n – встречаемость аллеля. Отклонение от теоретически ожидаемого распределения оценивали методом 2 (p 0,05). Оценку ООР и ООС в исследованных популяциях проводили на основании коэффициентов, предложенных Su B. и Manen (Su, Sun et al. 2000, van Manen, Kootstra et al.

2009). 27 возможных генотипов по трем полиморфным локусам генов CCR5, CCR2 и SDF1, в соответствии с данными литературы, разделили на 4 группы.

Для каждой группы использовали свой коэффициент относительного риска развития СПИД (РР) и смерти в результате СПИД (РС). Расчет ООР и ООС проводили по формуле:

–  –  –

где pi – частота встречаемости данной комбинации аллелей, а wi – коэффициент РР или РС для данной группы (табл. 20, 21) (Winkler, Modi et al.

1998, Su, Jin et al. 1999).

Табл. 20. Возможные варианты генотипов по трем исследованным локусам, объединенные в четыре группы, каждой из которых соответствует общий коэффициент относительного риска развития СПИД (РР) и смерти в результате СПИД (РС)(Su, Sun et al. 2000).

–  –  –

Табл. 21. Коэффициент относительного риска развития СПИД (РР) и смерти в результате СПИД (РС) для носителей аллелей генов HLA-C и HCP5 (van Manen, Kootstra et al. 2009)

–  –  –

где p – частота аллеля, N – число индивидуумов в выборке.

2.8 СИНТЕЗ ГЕНА Генетическая конструкция, включающая синтезированный фрагмент генома вируса гепатита С, приведена в приложении 2. Фрагмент генома (регион 5’UTR) был синтезирован и клонирован под CMV-промотором в плазмидный вектор pUCHR EGFP. Благодаря этому, удалось получить рекомбинантную плазмиду, содержащую общий промотор, целевой фрагмент, а также последовательность, кодирующую репортерный белок EGFP (рис. 8).

Синтезируемый фрагмент делили на участки по 50-55 нуклеотидов. Затем с помощью программного обеспечения 6.0 проектировали Oligo последовательности «верхних» (Top) олигонуклеотидов. К местам стыков олигонуклеотидов добавляли комплементарные «нижние» (Bottom) олигонуклеотиды, по 15-17 комплементарных нуклеотидов на каждый Topолигонуклеотид. Синтез и очистку гель-электрофорезом проводили на базе Лаборатории молекулярных технологий Отдела геномики и постгеномных технологий Института биоорганической химии им. академиков М.М.

Шемякина и Ю.А. Овчинникова РАН. Далее, делали смесь Topолигонуклеотидов (кроме первого), по 2 мкМ каждого в 1х лигазном буфере в присутствии АТР, (50 mM TRIS pH7.6, 10 mM MgCl2, 2 mM ATP, 0,1 mM spermidine, 5 mM DTT, 10 U T4 ПНК) и проводили обработку ПНК по стандартной методике (Grange 1991). ПНК инактивировали нагреванием при 85С в течение 15 минут. При приготовлении смеси Bottomолигонуклеотидов добавляли первый Тop-олигонуклеотид. После обработки ПНК и инактивации смешивали равные объемы смесей Вottom- и Тopолигонуклеотидов (по 5 мкл.). Смесь прогревали при 95С в течение 1 мин.

Разводили смесь в 5 раз 1х лигазным буфером (250 mM TRIS pH7.8, 20 mM DTT, 50 mM MgCl2), и оставляли на лигирование в присутствии T4 лигазы в течение ночи по стандартной методике (Herdewijn 2004). Смесь, содержащую лигированные продукты, разводили в 10 раз. Добавляли 1 мкл. смеси на 50 мкл ПЦР с концевыми праймерами. Клонирование целевых фрагментов проводили на базе Института биоорганической химии им. академиков М.М.

Шемякина и Ю.А. Овчинникова РАН. Специфичность синтеза определяли по стандартной методике с использованием автоматического секвенатора ABI PRISM® 310 Genetic Analyzer (Applied Biosystems, США) согласно рекомендациям производителя.

Рис. 8. Схематическое изображение синтетической конструкции, включающей CMV-промотор, фрагмент генома вируса гепатита С и последовательности репортерного белка EGFP.

–  –  –

2.10 КО-ТРАНСФЕКЦИЯ РЕКОМБИНАНТНЫХ ПЛАЗМИД И

СИНТЕТИЧЕСКИХ МОЛЕКУЛ МИРНК

Рекомбинантные плазмиды, несущие фрагмент-мишень генома HCV, а также синтетические молекулы миРНК ко-трансфецировали в клетки эмбриональной почки человека HEK293T на базе Лаборатории нанобиотехнологий ФГБУ «ГНЦ Институт иммунологии» ФМБА России.

Для этого клетки HEK293T засевали 12-луночный планшет в количестве 2105 клеток на лунку в объеме 1 мл полной среды DMEM (10% FBS, 300 мг/л глутамина, 80 мг/л гентамицина) и инкубировали в термостате при 37 0С в 5% атмосфере СО2 до образования монослоя 50%-ой конфлуентности.

Трансфицирующую смесь готовили в безсывороточной среде DMEM (300 мг/л глутамина, 80 мг/л гентамицина) в суммарном объеме 100 мкл. Для этого в отдельную пробирку добавляли 1 мкг необходимой плазмидной ДНК и 2 мкг миРНК и доводили объем раствора до 50 мкл безсывороточной средой DMEM. В отдельной пробирке готовили раствор 2 мкл коммерческого трасфецирующего реагента Lipofectamine2000 (Invitrogen) в безсывороточной среде DMEM объемом 50 мкл. Перемешивали раствор на вортексе и инкубировали при комнатной температуре 2-5 мин. Далее к 50 мкл смеси плазмидной ДНК (0,5 мкг) и кандидатных молекул миРНК (1 мкг) добавляли 50 мкл раствора Lipofectamine2000, смесь перемешивали и инкубировали при комнатной температуре 30 мин до образования комплекса.

После чего добавляли трансфицирующую смесь к клеткам в культуральную среду к клеткам с последующим инкубированием в течении 2 сут. При этом комплекс Lipofectamine2000-ДНК проникал в клетку и в результате чего плазмиды несущие фрагмент генома HCV и репортерный ген EGFP экспрессировались. Эффективность трансфекции составляла от 60 до 90% клеток, что оценивалось методом проточной EGFP-положительных цитометрии (цитометр FACScan, BectonDickinson, США).

2.11 ОБРАТНАЯ ТРАНСКРИПЦИЯ И ПОЛИМЕРАЗНАЯ ЦЕПНАЯ

РЕАКЦИЯ В РЕАЛЬНОМ ВРЕМЕНИ

Общую РНК из клеток HEK293T, ко-трансфецированных рекомбинантной плазмидой и кандидатными молекулами миРНК выделяли с помощью набора RNeasy Mini Kit (Qiagen) в соответствии с рекомендациями производителя. Реакцию ОТ проводили с помощью набора «Комплект-ОТ»

(ЗАО «НПФ ДНК-Технология», Россия) согласно инструкции производителя.

Для обратной транскрипции использовали специфические ОТ-праймеры (табл. 22). Для приготовления суммы ОТ-праймеров и дезоксирибонуклеотид трифосфатов (dNTP’s) 0,1 мкл DEPC распределяли наконечником по пробирке и добавляли 69,9 мкл. mQ. К раствору добавляли смесь dNTP’s (25 mM каждого) и по 10 мкл каждого из ОТ-праймеров, специфичных фрагменту 5’UTR вируса гепатита С (концентрация 10 пм/мкл). К одной реакции обратной транскрипции добавляли 2 мкл. ОТ-буфера, 1 мкл. суммы ОТ-праймеров и dNTP’s и 0,5 мкл обратной транскриптазы (Fermentas, США). К 3,5 мкл этой смеси добавляли 16,5 мкл выделенной тотальной РНК.

Реакционную смесь инкубировали при 40 0С в течение часа и при 950С в течение 15 минут на термостате «Гном» (ЗАО «НПФ ДНК-Технология», Россия).

Количественную ПЦР проводили с использованием праймеров, специфичных фрагменту 5’UTR вируса гепатита С и лежащих «ниже»

(downstream) места отжига ОТ-праймеров. Полимеразную цепную реакцию проводили в присутствии красителя Sybr Green I с использованием набора реактивов производства ЗАО «НПФ ДНК-Технология», Россия. К реакционной смеси добавляли по 0,14 мкл каждого праймера (100 пм/мкл), 0,24 мкл смеси dNTP’s (0,25 пм каждого), 0,75 мкл Sybr Green I (разведение в 1000 раз от стоковой концентрации) и раствор Taq-полимеразы 5U. Реакцию проводили в однократном растворе солей MgCl2, KCl и TRIS-HCl pH8,8, в конечном объеме 35 мкл (30 мкл ПЦР-смеси и 5 мкл образца кДНК) с использованием термоциклера «DT-96» (ЗАО «НПФ ДНК-Технология», Россия) по программе: 950С-10 секунд, 620С – 10 секунд 720С – 10 секунд в течение 40 циклов и со съемкой при 620С.

Табл. 22. Последовательности специфичных праймеров, использованных в реакциях ОТ и ПЦР в реальном времени.

–  –  –

2.12 СИНТЕЗ ОЛИГОНУКЛЕОТИДОВ Олигонуклеотиды были синтезированы на приборе 3400 DNA Synthesizer (Applied Biosystems, США) с использованием стандартных цианоэтил фосфорамидитных реагентов. В работе были использованы фосфорамидиты производства Glen Research (США). Олигонуклеотиды очищали методом высокоэффективной жидкостной хроматографии с использованием обращеннофазных колонок Диасфер-110-С18 (Россия).

2.13 ИСПОЛЬЗОВАННОЕ В РАБОТЕ ПРОГРАММНОЕ ОБЕСПЕЧЕНИЕ И

БАЗЫ ДАННЫХ

2.13.1 Программы и онлайн алгоритмы При создании праймеров пользовались алгоритмом BLAST Национального центра биотехнологической информации США (http://www.ncbi.nlm.nih.gov/BLAST/).

Для оценки вероятности формирования и стабильности вторичных структур на выбранных участках генома вируса гепатита С пользовались алгоритмом Mfold (http://mfold.rna.albany.edu/).

При построении множественных выравниваний (multiple alignment) пользовались алгоритмом сервера Европейского института ClustalW биоинформатики (www.ebi.ac.uk) При подборе праймеров к нуклеотидным последовательностям, а также рассчете приблизительной температуры отжига праймеров использовали программу Oligo.

Перевод в текстовый формат хроматограм, полученных в результате секвенирования, осуществляли с помощью программы Chromas.

Подбор молекул миRNA проводили с помощью онлайн алгоритма Target Finder (http://www.ambion.com/techlib/misc/siRNA_finder.html)

–  –  –

коллекцию общедоступных последовательностей ДНК, РНК и белков (http://www.ncbi.nlm.nih.gov/Genbank/index.html).

KEGG – база данных биохимических путей (www.genome.jp/kegg) STRING – база данных известных и предсказанных программными средствами взаимодействий белков (www.string-db.org) BioCarta – база данных биохимических путей (www.biocarta.com)

БУФЕРНЫЕ РАСТВОРЫ

Приготовление реактивов, входящих в состав наборов для амплификации.

Состав буфера для проведения ПЦР.

93 мМ Трис-HCl (рН 8,6) 25 мМ (NH4)2SO4 1,8 мМ MgCl2 0,003% Tween-20 Приготовление1,25 кратного ПЦР-буфера.

Для приготовления 1 л 1,25x-буфера слить 116 мл 1М Tris-HCl pH 8,6, 4,5 мл 0,5М MgCl2, 0,38 мл 10% Tween-20 и довести объем mQ примерно до 900 мл.

Растворить в 50 мл mQ 4,6 г сульфата аммония и прилить к основному раствору. Довести объем до 1 л в мерной посуде. Стерилизовать автоклавированием. Хранить при +4С.

Состав TE-буфера.

10 мМ Tris-HCl (pH 8,6) 1 мМ ЭДТА Приготовление ТЕ – буфера.

Для приготовления 1,0 л буфера в мерном стакане на 1000 мл смешать 10 мл 1М Tris-HCl pH 8,6 и 5 мл 0,2М ЭДТА рН 8,0. Добавить mQ примерно до 950 мл, проверить рН: если необходимо – довести с помощью 2N HCl.

Довести объем до 1 л.

113

3. РЕЗУЛЬТАТЫ

3.1 РАЗРАБОТКА ЛАБОРАТОРНОГО ВАРИАНТА ГЕНОТИПИРУЮЩИХ

ТЕСТ-СИСТЕМ В настоящем исследовании для генотипирования использовались два метода: метод аллель-специфичной ПЦР, а также метод ПЦР с оценкой температуры плавления дуплексов синтетических аллель-специфичных проб и ДНК-мишени (рис. 9) А Б

–  –  –

ПЦРпродукт Рис. 9. Для проявки накопления ДНК использовали гидролизующиеся пробы (А) и примыкающие пробы (Б). Флуоресценция первых обусловлена экзонуклеазной активностью Taq-полимеразы, а вторых денатурацией примыкающих проб при нагревании (плавление).

114 Первые основаны на различии в способности Taq-полимеразы удлинять полностью комплементарные и частично некомплементарные матрице затравки (праймеры) (Кофиади 2006). Для идентификации аллелей проводят ПЦР с праймерами, каждый из которых полностью совпадает только с одним из вариантов последовательности.

Вариабельный нуклеотид располагают в 3’-концевой части аллель-специфичного праймера. Условия реакции подбирают так, чтобы максимизировать разницу в эффективности удлинения «правильно» и «неправильно» гибридизованного праймера. Таким образом, если анализируемый образец содержит только один вариант последовательности (то есть гомозиготен по данному полиморфизму), продукт, синтезируемый с полностью комплементарного матрице праймера, образуется в ПЦР существенно раньше, нежели продукт с частично некомплементарного праймера. Если же анализируют гетерозиготный образец, и тот и другой праймер сработают примерно одинаково (рис. 10).

Второй тип тест-систем основан не на эффективности удлинения аллельспецифичных праймеров, а на эффективности гибридизации аллельспецифичных олигонуклеотидных проб на содержащий полиморфизм продукт ПЦР. Иными словами, полиморфный нуклеотид входит в структуру пробы, а не праймера.

Продукт ПЦР в данном случае получают с использованием общей для всех аллелей пары праймеров, а в реакционную смесь добавляют столько аллель-специфичных проб, сколько аллелей необходимо различить (при этом каждая проба помечена своим флуорофором и полностью комплементарна лишь «своему» аллелю). Если анализируемый образец содержит только один вариант последовательности (то есть гомозиготен по данному полиморфизму), температура денатурации полностью комплементарной пробы будет выше температуры денатурации частично некомплементарной пробы (рис. 10в). Если же анализируют гетерозиготный образец, обе пробы будут денатурировать на примерно одинаковых температурах (рис. 10г).

В Г

–  –  –

Рис. 10. Графики накопления ДНК, полученные с помощью амплификатора ДТ-96. А,Б-метод гидролизующихся проб. A – результат исследования гомозиготного образца. Синяя кривая соответствует накоплению продукта реакции с частично некомплементарного праймера; Б – результат исследования гетерозиготного образца. В,Г-Метод плавления ДНКдуплексов. В - результат исследования гомозиготного образца. Зеленая кривая отражает динамику денатурации частично некомплементарного праймера; Г - результат исследования гетерозиготного образца

–  –  –

специфичных праймеров. Регистрация накопления ДНК в ходе реакции позволяет избежать отдельной стадии определения результатов, исключить загрязнение лаборатории продуктами реакции, проводить количественный анализ нуклеиновых кислот.

Критерии работоспособности тест-систем включали несколько параметров:

При анализе гомозиготного образца график накопления ПЦР-продукта с частично некомплиментарного праймера должен отставать по значению от графика накопления ПЦР продукта с полностью Ct комплиментарного праймера не менее чем на 4 цикла.

При анализе гетерозиготного образца Ct графиков накопления ПЦР продукта не должны различаться более чем на один цикл.

Коэффициент отношения уровня специфичного сигнала к фоновой флуоресценции должен быть не менее 5.

Результат генотипирования одного и того же образца должен быть воспроизводим в серии из пяти экспериментов.

Использованный метод продемонстрировал исключительную точность анализа и высокую эффективность.

Тест-системы для определения аллелей HCP5 rs2395029 и HLA-C основаны на использовании аллель-специфичных проб.

rs9264942 Использованная в работе модификация метода позволяет проводить детекцию обоих аллелей ДНК в одной пробирке. Условия реакции подбирали так, чтобы максимизировать разницу в эффективности гибридизации/денатурации полностью комплементарной и частично некомплементарной пробы. Регистрацию сигнала осуществляли при помощи молекул флуорофора (по одному на каждый из тестируемых аллелей) и «гасителя флуоресценции».

3.1.2 Генотипирующие тест-системы для определения фармакогенетических маркеров, ассоциированных с развитием гиперчувствительности у лиц, принимающих препараты АРТ Аллель HLA-B*57:01 методом ПЦР в реальном времени.

Сложность с разработкой ПЦР-тест-систем для определния аллельных вариантов генов HLA заключается в высоком уровне полиморфизма генов главного комплекса гистосовместимости. Подобрать специфичный для данного аллеля фрагмент в ряде случаев практически невозможно. Однако в случае с аллелем HLA-B*57:01 удалось подобрать регионы, отличие которых от близких по последовательности аллельных вариантов определяло достаточную для анализа специфичность. Дополнительный вклад в надежность определения аллеля должно было внести HLA-B*57:01 использование пробы, специфичной для группы аллелей HLA-B*57.

Последовательности праймеров и пробы приведены в табл. 23. Подбором условий реакции удалось добиться отсутствия амплификации для всех аллелей кроме HLA-B*57:01 (рис.11) Табл. 23. Последовательности праймеров и пробы для детекции аллеля HLAB*57:01 методом ПЦР в реальном времени.

Праймер Последовательность B57-d GCAGGGAAATGG CCTCTGTAG G B57-r ATCCTTGCCGTCGTAGGCGG Проба Последовательность B57-fp (BHQ)-ATCATCCAGGTGA(FDT)GTATGGCTGCG-(P) Группу аллелей HLA-DRB*01 определяли методом ПЦР в реальном времени с помощью тест-систем предоставленных ЗАО «НПФ ДНКТехнология». Этот метод более удобен по сравнению с секвенированием, однако не позволяет получить необходимого уровня разрешения. В дальнейшем при установлении конкретных вариантов, ассоциированных с риском развития радиационных осложнений онкологического генеза необходим переход на уровень аллельных вариантов.

Для разработанных тест-систем показана высокая эффективность и чувствительность.

Рис. 11. Необработанные данные для 96 образцов (справа) и те же данные в логарифмическом масштабе (справа) 3.1.3 Генотипирующие тест-системы для определения маркеров устойчивости/чувствительности к развитию радиационных осложнений онкологического генеза В ходе работы созданы тест-системы для выявления аллелей генов ATM (rs1801516, rs664677), TGFB1 (rs1800469), XRCC1 (rs1799782), OGG1 (rs1052133), IL-7 (rs2717536), IL15-RA (rs2296135), rs9642880, rs13281615, rs1447295 в геноме человека методом ПЦР в реальном времени. Все они основаны на оценке температуры плавления дуплексов синтетических аллель-специфичных проб и ДНК-мишени.

Использованные в работе тест-системы могут быть рекомендованы к применению в лабораторной практике Точность генотипирующих тестсистем была подтверждена повторным генотипированием выборки образцов методом секвенирования по Сэнгеру (Sanger, Nicklen et al. 1977).

3.2 ГЕНОТИПИРОВАНИЕ ОБРАЗЦОВ

В части исследования, посвященной установлению особенностей популяционного распределения маркеров устойчивости/чувствительности к ВИЧ-инфекции/СПИД с помощью разработанных тест-систем были определены генотипы представителей 12 популяций по пяти полиморфным локусам: CCR5delta32 rs333, CCR2-64I rs1799864, SDF1-3’A rs1801157, HCP5 rs2395029 и HLA-C rs9264942. Результаты приведены в таблицах 24 и 25.

–  –  –

В части исследования, посвященной установлению ассоциации генетических маркеров с устойчивостью/чувствительностью к развитию радиационных осложнений онкологического генеза, с помощью разработанных тест-систем были определены генотипы 220 образцов по 7 полиморфизмам: ATM (rs1801516, rs664677), TGFB1 (rs1800469), XRCC1 (rs1799782) OGG1 (rs1052133), IL-7 (rs2717536), IL15-RA (rs2296135).

Табл. 25. Частоты генотипов по полиморфным локусам HCP5 rs2395029 и HLA-C rs9264942.

–  –  –

Дополнительно, для оценки возможной ассоциации генетических маркеров с риском развития онкопатологий в группах сравнения использовали тест-системы, позволяющие определять генотип по 4 аллелям локуса 8q24, изготовленные в рамках научно-исследовательской разработки, проводимой отделом иммуногенетики ФГБУ «ГНЦ Институт иммунологии»

совместно с РОНЦ им. Н.Н.Блохина РАМН. Результаты генотипирования приведены в таблице 26.

Генотипирование по 34 аллелям генов HLA-DRB1, DQA1 и DQB1 проводили с помощью тест-систем, предоставленных ЗАО «НПФ ДНКТехнология». Тест-системы позволяют в режиме реального времени определять аллели генов HLA на уровне групп аллелей. Результаты генотипирования приведены в таблице 27.

–  –  –

3.3 ПРОВЕРКА СООТНОШЕНИЯ ХАРДИ-ВАЙНБЕРГА В

ИССЛЕДОВАННЫХ ПОПУЛЯЦИЯХ

В полиморфной, панмиктической (характеризующейся свободным скрещиванием) популяции, состоящей из одинаково жизнеспособных и одинаково плодовитых особей, различные гомозиготные и гетерозиготные генотипы быстро достигают некоторых равновесных частот, зависящих от существующих в популяции частот аллелей (Balding 2006). Распределение частот генотипов в такой популяции описывается уравнением ХардиВайнберга:

–  –  –

воздействующие на частоту генотипов, кроме самого процесса воспроизведения особей. До тех пор, пока уровень изменчивости в генофонде определяется воспроизведением как таковым, этот уровень остается постоянным и неизменным в ряду последовательных поколений.

Для проверки гипотезы о соответствии распределения экспериментальных и теоретических частот генотипов, полученные результаты сравнивали с равновесным распределением Харди-Вайнберга.

Для сравнения использовали критерий 2.

Для всех групп сравнения исследованных в настоящей работе отклонения частот генотипов от равновесия Харди-Вайнберга были незначимы на 5% уровне значимости.

3.4 ИЗУЧЕНИЕ ОСОБЕННОСТЕЙ ЧАСТОТНОГО РАСПРЕДЕЛЕНИЯ

ИССЛЕДОВАННЫХ МАРКЕРОВ В ПОПУЛЯЦИЯХ РОССИИ И

СОПРЕДЕЛЬНЫХ ГОСУДАРСТВ

3.4.1 Популяционное распределение маркера CCR5delta32 rs333 Частоты аллеля CCR5delta32 представлены на рисунке 12.

Аллель CCR5delta32 наиболее представлен в выборке поморов. Его частота достоверно выше, чем в других, изученных в данной работе, выборках. Кроме того, частота аллеля в популяции русских поморов превышает частоты для изученных ранее популяций северных регионов Западной и Восточной Европы (alfred.med.yale.edu, Кожекбаева 2004).

Распределение частот варианта в изученном регионе CCR5delta32 характеризуется отрицательным градиентом в направлении с севера на юговосток (рис.13).

Аллель CCR5delta32 наименее представлен в популяции тувинцев, казахов, киргизов и чеченцев (центрально-азиатская и северо-кавказская группы). Казахи и киргизы принадлежат южно-сибирской этнической группе

– промежуточной между европеоидной и монголоидной расами, а тувинцы являются представителями монголоидной расы. В этих случаях полученные нами данные соотносятся с проводимыми ранее исследованиями, демонстрирующими низкую распространенность аллеля CCR5delta32 в азиатских популяциях (Su, Sun et al. 2000).

Рис. 12. Распределение частот аллелей CCR5delta32 и CCR2-64I в исследованных популяциях.

На границах ареала монголоидной расы имеются плавные переходы в европеоидную, уральскую и южносибирскую расы. Примесь монголоидной составляющей в южных популяциях большой европеоидной расы (чеченцы) и переходной уральской (туранский тип) группе (татары, удмурты) могла повлиять на формирование генофонда, характеризующегося пониженной представленностью аллеля CCR5delta32 по сравнению с популяциями восточно-европейского региона.

В изученных нами восточно-европейских популяциях частота аллеля CCR5delta32 повышена. Аллель одинаково представлен в выборках украинцев, русских и гагаузов.

Общая картина распределения аллеля позволяет CCR5delta32 предположить, что рассматриваемая мутация могла возникнуть и закрепиться в популяциях северной части Европы и уже затем постепенно распространиться в соседние регионы (Асеев 1997).

Таким образом, гетерогенность в распределении протективного аллеля CCR5delta32 на территории изученных регионов связана, в первую очередь, с участием европеоидного и монголоидного компонентов в этногенезе народов, проживающих на территории России. Полученные нами результаты подтверждают и дополняют существующие данные молекулярногенетического анализа пространственной структуры генофонда восточноевропейских и центрально-азиатских народов (Лимборская 2002).

Рис. 13. Распределение частот аллеля CCR5delta32 в изученном регионе демонстрирует изменчивость в направлении с севера на юго-восток.

3.4.2 Популяционное распределение маркера CCR2-64I rs1799864 В отношении аллеля CCR2-64I нами были обнаружены достоверные отличия для чеченцев, казахов и киргизов (северо-кавказская и центральноазиатская группы) относительно других рассмотренных групп (рис. 12).

В пределах восточно-европейской и Волго-Уральской этнографических групп обнаружены достоверные отличия для гагаузов относительно других популяций. Эти данные коррелируют с данными о миграционных потоках со стороны южных (Греция, Болгария) регионов Европы, где частота аллеля демонстрирует повышенные значения (Лимборская 2002).

CCR2-64I Значимых отличий в других этнических группах восточно-европейского региона обнаружено не было.

Отдельного упоминания стоит рассмотренная выборка из популяции тувинцев. Здесь частота аллеля CCR2-64I зафиксирована на самом низком уровне. Причиной этому могла послужить географическая изолированность республики. Полученные нами данные позволяют предположить, что формирование генофонда тувинской популяции находилось под влиянием миграционных потоков, проникавших на территорию восточной Сибири из южных областей азиатского региона, где частота полиморфизма CCR2-64I ниже, относительно центральной Азии.

3.4.3 Популяционное распределение маркеров SDF1-3’A rs1801157, HCP5 rs2395029 и HLA-C rs9264942 Аллели SDF1-3’A rs1801157, HCP5 rs2395029 и HLA-C rs9264942 в пределах исследованных популяций распространены равномерно.

Обнаруженные отличия не достоверны и не позволяют выявить тенденций в их распределении. Частоты маркеров HCP5 rs2395029 и HLA-C rs9264942 обнаруживают характерный для популяций европейского происхождения паттерн распределения. Единственное значимое отличие отмечено нами для популяции гагаузов, где частота аллеля SDF1-3’A rs1801157 достоверно 128 выше, чем у представителей популяций Украины и европейского региона России.

Если сопоставить данные по частоте аллелей CCR2-64I и SDF1-3’A с основными путями миграции в азиатском регионе, видно, что изменение частот аллелей совпадает с направлением миграционных потоков. По одной из существующих на сегодняшний день гипотез, современные люди попали на территорию центральной Азии примерно 50000-70000 лет назад с юга, вероятно из юго-восточной Азии (где частота аллеля SDF1-3’A высокая), и, в дальнейшем, распространились на север Азии. Вместе с тем, последующие 7000 лет миграции на территории Китая были направлены с севера на юг – из области с высокой частотой CCR2-64I (Su, Sun et al. 2000). Противоположная направленность в распределении частот протективных аллелей CCR2-64I и SDF1-3’A на территории азиатского региона отчасти подтверждает эту гипотезу.

3.4.4 Популяционное распределение маркеров HLA-B*57:01 и HLADRB1*01 Нами установлены частоты аллелей HLA-B*57:01 и HLA-DRB1*01, ассоциированных с развитием побочных эффектов при приеме антиретровирусных препаратов в русской популяции.

Частота аллелей выбранных HLA-маркеров, установленная в выборке из 800 здоровых представителей русской популяции, составила 5% для HLAB*57:01 и 22% для HLA-DRB*01.

3.4.5 Популяционное распределение маркеров ATM (rs1801516, rs664677), TGFB1 (rs1800469), XRCC1 (rs1799782), OGG1 (rs1052133), IL-7 (rs2717536), IL15-RA (rs2296135), rs9642880, rs6983267, rs1447295 и rs13281615 Группа облучённых людей, проживающих в селах на побережье р. Теча, неоднородна по этническому составу. Часть группы (43%) представлена лицами тюркской этнической принадлежности (татары, 129 башкиры). Чтобы исключить возможность отклонений, вызванных отличиями в распределении маркеров в различных популяциях, нами был проведен сравнительный анализ частот аллелей исследованных SNP в референтных популяциях азиатского (CHB) и европейского (CEU) происхождения, представленных в базе данных HapMap относительно выборки P из русской популяции.

По результатам анализа большинство SNPмаркеров за исключением rs1052133 (ген OGG1), rs1801516 (ген ATM) и rs1799782 (ген XRCC1) попали в группу, характеризующуюся сходным распределением во всех трех группах сравнения. Таким образом, можно исключить влияние фактора геномного разнообразия отдельных популяций, этносов, этнотерриториальных сообществ (популяционной стратификации) при исследовании распределения маркеров в выбранных группах. Отличия в частоте аллелей генов OGG1, ATM и XRCC1 установлены только для групп P и CHB. В то же время в группе P и CEU указанные маркеры распределены одинаково (без статистически достоверных отличий) (рисунок 14).

1,2 1 0,8

–  –  –

Рис. 14. Сравнительный анализ распределения аллелей исследованных SNPмаркеров. A-собственные данные, основанные на распределении аллелей в группе P относительно референтных популяций азиатского и европейского происхождения.

Частота аллеля G в гене OGG1 варьирует от 0,22 среди европейцев до 0,55 в популяциях Китая и Японии. Другой маркер, rs1801516, расположенный в гене ATM (аллель T), практически не встречается в популяциях азиатского происхождения и, напротив, широко распространен в европейской этнической группе (0,19). Частоты аллелей SNP-маркеров поразному представленных в популяциях европейского и азиатского региона могут отличаться и в пределах популяционной системы населения России.

Это может приводить к искажению результатов исследования. Однако, по данным о распределении SNP-маркеров в евроазиатском регионе, генофонд популяций, проживающих на территории центральной части и ВолгоУральского региона России, в большей степени испытывает на себе влияние «притока генов» со стороны Европы (Кофиади 2011). Кроме того, по результатам исследования полиморфизма генов системы HLA, русские, татары и башкиры принадлежат одному этническому кластеру, что позволяет предположить сходное распределение эволюционно-стабильных независимых SNP-маркеров, в этих популяциях (Болдырева 2005). Это дает основания к рассмотрению исследованных групп в составе общей по этнической принадлежности выборки и позволяет исключить влияние фактора популяционной стратификации на результат исследования.

3.5 ОПРЕДЕЛЕНИЕ ОТНОСИТЕЛЬНОЙ ОПАСНОСТИ РАЗВИТИЯ СПИД

И СМЕРТИ В РЕЗУЛЬТАТЕ СПИД В ИССЛЕДОВАННЫХ ПОПУЛЯЦИЯХ

На основе частот трехлокусных генотипов для изученных популяций рассчитаны значения относительной опасности развития СПИД (ООР) и смерти от СПИД (ООС) у ВИЧ-инфицированных.

В рассмотренных нами выборках значения ООР и ООС для трехлокусных генотипов попадают в интервал 0,79-0,94 и 0,76-0,93, (табл.

28), а для аллелей HLA-C и HCP5 0,44-0,51 и 0,42-0,51 соответственно. В целом, они соответствуют данным, полученным для других европейских и азиатских популяций (Su, Sun et al. 2000, Ioannidis, Rosenberg et al. 2001).

Широкое распространение аллеля CCR2B-64I в центрально-азиатскиой группе обусловило пониженные значения ООР и ООС. Напротив, в выборке тувинцев и популяциях Волго-Уральской группы, относительный риск демонстрирует повышенные значения, что связано с низкой частотой протективных аллелей CCR5delta32 и CCR2B-64I. У восточно-европейских народов и выборки чеченцев установлен средний уровень ООР и ООС. В первом случае оказывает влияние распространенность варианта CCR5delta32, а во втором CCR2-64I.

–  –  –

3.6 АССОЦИАЦИЯ МАРКЕРОВ ГЕНОВ СИСТЕМ РЕПАРАЦИИ ДНК И

ИММУННОГО ОТВЕТА В ГРУППАХ СРАВНЕНИЯ С РИСКОМ

РАЗВИТИЯ РАДИАЦИОННЫХ ОСЛОЖНЕНИЙ ОНКОЛОГИЧЕСКОГО

ГЕНЕЗА

–  –  –

В настоящее время представления о роли конкретных аллелей гена в формировании предрасположенности к онкозаболеваниям XRCC1 противоречивы. Разными научными коллективами получены данные, как о прямой, так и об обратной связи вариантов гена с риском развития злокачественных новообразований (Lee, Lee et al. 2001, Stern, Umbach et al.

2001, Chang-Claude, Popanda et al. 2005). Результаты, полученные в настоящей работе, служат вкладом в дальнейшее развитие представлений о роли гена XRCC1 в механизме канцерогенеза.

Из 34 аллелей HLA класса II единственная достоверная ассоциация с признаком устойчивости к радиационному воздействию установлена для группы аллелей HLA-DRB1*11. Помимо этого, нами обнаружены группы аллелей в генах HLA-DRB1 и HLA-DQB1, перспективные для дальнейшего исследования в более широких группах. Данные по распределению аллелей HLA класса II в группах индивидуумов с повышенной/пониженной устойчивостью к радиации получены впервые. Результаты настоящей работы открывают новые представления о роли молекул главного комплекса гистосовместимости в радиационной генетике.

В настоящем исследовании не удалось подтвердить описанную ранее ассоциацию варианта TGFB1 (rs1800469) с повышенным риском развития онкологических заболеваний (Bhayal, Prabhakar et al. 2011, Slattery, Herrick et al. 2011). Не удалось также установить ассоциации с аллелями rs2717536, rs2296135 (гены IL7 и IL15RA, соответственно) и аллелями локуса 8q24.

3.7 РАЗРАБОТКА НОВОГО ПОДХОДА К МОНИТОРИНГУ ВИРУСНОЙ

ИНФЕКЦИИ У ВЗРОСЛЫХ РЕЦИПИЕНТОВ ПОЧЕЧНОГО

ТРАНСПЛАНТАТА

Целью данной части работы стала разработка комплекса тест-систем, позволяющих осуществлять качественную и количественную диагностику вирусных инфекций (CMV, EBV, HHV-6, HSV, BK, JC, TTV) в биообразцах реципиентов почечного трансплантата. Другой нашей целью стало исследование применимости показателя вирусной нагрузки в качестве маркера адекватности терапии. В ходе работы нами было проведено сравнение различных биологических образцов (цельная кровь и моча), как материала для генодиагностики полиомавирусной инфекции.

С помощью метода ПЦР в реальном времени мы провели количественный анализ уровня вирусной ДНК (CMV, EBV, HHV-6, HSV, вирусов BK, JC и TTV) в цельной крови 32 пациентов в динамике; из них для 24 пациентов в параллели был проведен анализ мочи на наличие полиомавирусов BK и JC. Кроме того, у 105 реципиентов почечного трансплантата была проведена однократная оценка вирусной нагрузки. Так же, как и в случае с пациентами в динамике количественный анализ полиомавирусов проводили в двух типах биоматериалов – крови и моче.

Положительным считали любой образец, для которого был обнаружен достоверный сигнал. При этом количественная оценка для образцов с вирусной нагрузкой менее 1х103 копий геномов на мл (минимальное значение линейного диапазона) не проводилась.

По меньшей мере, один из вирусов был обнаружен в крови 98% пациентов, из них два вируса у 31%, три и более у 6%. Наиболее часто встречающимся является вирус TTV(98%). Интересно отметить, что в единичных случаях отсутствия TTV отсутствуют и любые другие инфекции.

В ходе анализа нами не выявлено ни одного случая инфицирования HSV. На рисунке 15 приведены данные по встречаемости вирусов CMV, EBV, HHV-6, BKV, JCV, HSV и TTV у реципиентов почечного трансплантата, изученных в настоящей работе.

Поскольку полиомавирусы и локализуются в почках BK JC иммунокомпрометированных реципиентов трансплантата (редко в респираторной системе и головном мозге), нами было проведено сравнение количества детектируемых вирусных ДНК в крови и в моче. Результаты анализа представлены в таблице 30. Было выявлено достоверное превышение случаев детекции полиомавирусов в моче по сравнению с кровью.

Рис. 15. Частота встречаемости вирусов в крови реципиентов почечного трансплантата (данные по 137 пациентам).

–  –  –

При исследовании ДНК, полученной из образцов мочи 24 пациентов, в 11 случаях была обнаружена ДНК вируса BK. При этом у 4 человек вирусная нагрузка составляла менее 1x103 копий ДНК вируса/мл образца, а у остальных колебалась в пределах 1х103- 1х107. Интересно, что при рассмотрении этих пациентов в динамике обнаружилось, что в четырех случаях вирусная нагрузка со временем не изменилась и осталась на первоначальном уровне менее 1х103 копий/мл. При этом у двух пациентов с повышенной вирусной нагрузкой количество вирусной ДНК уменьшилось в 50-100 раз, а у пяти увеличилось в 10-100 раз. ДНК вируса JC была обнаружена у трех пациентов. При этом у двоих из них динамика показателей вирусной нагрузки демонстрировала тенденцию к повышению, а у одного к понижению (табл. 31).

–  –  –

В качестве группы сравнения исследовали образцы мочи, полученные от 17 здоровых доноров. Ни в одном случае не было выявлено присутствие ДНК вируса BK. При этом ДНК вируса JC в ряде случаев была выявлена.

Результаты количественного анализа вирусной нагрузки CMV, EBV, HHV-6, BK, JC и TTV в образцах крови 32 пациентов представлены в таблице 32.

ДНК вирусов HSV и JC в исследованных образцах крови обнаружено не было. Было выявлено 12 случаев инфицирования HHV-6. 10 из них были впервые детектированы при повторном анализе. Только в двух случаях удалось проследить динамику инфекции: в одном случае количественные показатели вирусной нагрузки были неизменны, и лишь у одного пациента была отмечена положительная динамика. Вирус BK обнаружили у 4 пациентов в количестве менее 1х103 копий/мл образца. При повторном взятии материала через несколько дней BK выявлен не был. Вирусы CMV и EBV были обнаружены в крови 10 и 7 пациентов, соответственно. При повторном анализе была отмечена, как положительная, так и отрицательная динамика показателя вирусной нагрузки. При этом следует отметить, что у пациентов с двумя и более вирусными инфекциями изменение вирусной нагрузки практически всегда было однонаправлено. Исключение составляют лишь единичные случаи, когда при общей положительной динамике повторное взятие материала выявляло новую инфекцию (чаще всего HHV-6).

Вирус TTV обнаружен у всех пациентов.

–  –  –

Таким образом, нами разработан комплекс тест-систем для экспрессскрининга (3-4 часа) патогенов, способных вызывать реактивацию латентных вирусных инфекций у реципиентов почечного трансплантата. Установлена высокая чувствительность и специфичность этих систем. ПЦР в реальном времени является по сути единственной на сегодняшний день методикой, позволяющей оценивать количество вирусных частиц. Кроме того, она основана на прямой детекции нуклеиновых кислот и исключает вероятность получения ложноотрицательных результатов.

3.8 РАЗРАБОТКА ПОДХОДА К МОНИТОРИНГУ ЭФФЕКТИВНОСТИ

ПРОТИВОВИРУСНЫХ ПРЕПАРАТОВ НА ОСНОВЕ АНТИСМЫСЛОВЫХ

ТЕХНОЛОГИЙ

Целью данной части работы стала разработка кандидатных препаратов миРНК к вирусу гепатита С, а также оценка их ингибирующей активности.

Для этого была синтезирована регуляторная последовательность 5’UTR вируса гепатита С. Последовательность синтезированного фрагмента генома гепатита С соответствовала референтным последовательностям генома вируса гепатита С субтипа 1b, депонированным в интернет-базах данных.

Данный субтип вируса является наиболее распространенным на территории Российской Федерации.

Выбранный участок генома HCV играет принципиальную роль в реализации репликативного цикла вируса (Kolykhalov 2000). Регион 5’UTR содержит регуляторные последовательности необходимые для трансляции и репликации вируса. Около 90% последовательности региона 5’UTR являются общими для различных генотипов вируса. Однако, в то же время, некодирующие последовательности генома HCV формируют не менее консервативные вторичные и третичные структуры, которые способны понизить эффективность РНК-интерференции.

Структура целевых последовательностей была проанализирована с помощью специализированной программы. При подборе участка для ингибирования учитывалась вероятность формирования вторичных структур полинуклеотидной цепи и их стабильность. Кроме того оценивалась степень соответствия кандидатных молекул ингибирующих РНК необходимым критериям (Reynolds, Leake et al. 2004, Matveeva, Nechipurenko et al. 2007):

повышенное содержание A/U на 5’ конце антисенс-цепи и G/C на 5’ конце смысловой цепи (эта асимметрия важна при определении направления расплетания цепи) наличие по крайней мере пяти оснований A/U в последней трети антисенс-цепи с 5’ конца отсутствие GC повторов протяженностью более 9 п.н.

отсутствие инвертированных повторов Последовательность спроектированных ингибирующих РНК проверяли на сходство с последовательностями генов человека, чтобы избежать неспецифического подавления экспрессии генов человека.

Выбранный участок генома HCV был клонирован в плазмидный экспрессионный вектор, под один промотор с репортерным геном EGFP.

Благодаря этому удалось получить экспериментальную модель, позволяющую оценить эффективность ингибирования фрагментов РНКгенома гепатита С в клетках эмбриональной почки человека HEK293T.

Культура клеток эмбриональной почки человека HEK293T обладает высокой трансфекционной и экспрессионной способностью. Применяя коммерческие трасфекционные реагенты, такие как Lipofectemine 2000 (Invitrogen), использованный в данной работе, удавалось добиться высокой эффективности трансфекции клеток HEK293T, от 50 до 90% всей популяции клеток, что очень важно при тестировании спроектированных миРНК, которые необходимо доставлять в клетки в большой концентрации.

Созданная модель экспрессии фрагмента генома вируса гепатита С в клетках HEK293T была использована для тестирования эффективности сайленсинга спроектированными молекулами миРНК. В качестве положительно контроля использовали препарат молекулы siGFP, которая, по нашим данным, подавляла экспрессию EGFP до 10 раз. В качестве положительно контроля использовали молекулу siP4, направленную против гена р респираторно-синцитиального вируса. Последовательность данных ингибирующих РНК не имеет 100% сходства ни с последовательностями выбранных фрагментов генома гепатита С ни с последовательностью EGFP.

Для оценки экспрессии генов использовали метод проточной цитометрии. Однако наиболее точным методом, позволяющим оценить относительные количественные характеристики уровня экспрессии, является ПЦР в реальном времени. Получив кДНК с РНК-транскриптов, можно оценить относительное количество исходных копий специфической РНКмишени.

На рисунке 16 приведены результаты цитометрического анализа и обратной транскрипции с последующей ПЦР в реальном времени для тотальной РНК, полученной из культур клеток, обработанных различными молекулами миРНК, а также положительных и отрицательных контролей.

эффективность ингибирования региона 5'UTR

–  –  –

А Б Рис. 16 - Оценка эффективности ингибирования региона 5’UTR гепатита С.

А - Эффективность ингибирования региона 5’UTR генома вируса гепатита С (метод проточной цитометрии). Б - Эффективность ингибирования региона 5’UTR генома вируса гепатита С (метода ПЦР в реальном времени с обратной транскрипцией).

Красным обозначены клетки, содержащие плазмиду и не обработанные миРНК, а также клетки, содержащие плазмиду и обработанные неспецифичной миРНК (положительные контроли).

Синим обозначены клетки без плазмиды (отрицательный контроль).

Зеленым обозначены клетки, обработанные различными препаратами ми РНК.

Черным обозначены клетки с плазмидой, экспрессия в которых подавлена препаратом ми/кшРНК, специфичным к гену EGFP.

По результатам количественного анализа видно, что уровень экспрессии плазмиды в целом соответствует данным, полученным с помощью метода проточной цитометрии.

Таким образом, разработанную модель экспрессии можно в дальнейшем использовать для тестирования различных вариантов миРНК, направленных против гепатита С. Наиболее эффективные варианты ингибирующих молекул в дальнейшем можно будет испытывать в экспериментах in vivo. Это позволит оценить возможность применения данного подхода, заключающегося в сайленгсинге генов к HCV, профилактике и терапии гепатита С и ассоциированных с ним заболеваний.

4. ОБСУЖДЕНИЕ

4.1 ИММУНОГЕНОТИПИРОВАНИЕ, КАК ПОДХОД К УСТАНЛЕНИЮ

ЕСТЕСТВЕННОЙ УСТОЙЧИВОСТИ/ЧУВСТВИТЕЛЬНОСТИ К ВИЧИНФЕКЦИИ/СПИД НА ИНДИВИДУАЛЬНОМ И ПОПУЛЯЦИОННОМ

УРОВНЕ

ВИЧ-инфекция остается одной из важнейших проблем всемирного здравоохранения, демонстрируя признаки увеличения выявления новых случаев инфицирования во многих регионах. За 30 с небольшим лет, прошедших с начала эпидемии, от ВИЧ/СПИД уже умерли 25 миллионов человек (Merson 2006). Для борьбы с эпидемией такого размаха необходимо разрабатывать комплексные подходы с привлечением всех возможных средств, включая внедрение превентивных технологий и всего спектра научных исследований и разработок (Baeten, Donnell et al. 2012, Parai, Huggins et al. 2012, Zak and Aderem 2012).

Широкому распространению ВИЧ на начальных этапах развития пандемии способствовала беспомощность мировой системы здравоохранения перед лицом новой биологической угрозы. Несмотря на беспрецедентный размах финансирования программ по изучению ВИЧ остановить распространение инфекции не удалось до сих пор.

Основным препятствием в борьбе с ВИЧ является уникальная изменчивость вируса. В пределах одного хозяина вирус формирует популяцию, характеризующуюся сходными, но неидентичными геномами.

Более того, и эта популяция динамична и постоянно изменяется. В основе такой полиморфности лежат следующие механизмы. В первую очередь, это низкая точность обратной транскриптазы ВИЧ и высокая скорость репликативного цикла. В среднем за один цикл репликации в геноме появляется одна замена, при этом в пределах одного хозяина вирус продуцирует около 1010 новых вирионов в день (Ho 1997). За счет рекомбинации две молекулы РНК, представляющие геном вируса 143 упаковываются в вирион по-разному, формируя мозаичные геномы дающие начало новым в генетическом плане потомкам. За один раунд репликации может произойти до 30 рекомбинаций (Levi, Fernandes et al. 2004).

При этом следует учесть, что разрешающая способность методов, позволяющих оценить уровень полиморфизма вирусного генома, до последнего времени была невысокой. Большей частью подходы к решению этой задачи основаны на определении консенсусных последовательностей доминантных для данной популяции штаммов (Bimber, Dudley et al. 2010).

Таким образом, важная часть информации, позволяющей судить о реальных масштабах гетерогенности популяций ВИЧ, остается за пределами внимания исследователей. Недооценка потенциала ВИЧ к изменению является препятствием на пути к пониманию аспектов эволюции вируса, основ патогенетического влияния вируса на иммунную систему, а также механизмов формирования устойчивости ВИЧ к лекарственным препаратам.

Проблемы с созданием эффективных анти-ВИЧ препаратов, будь то вакцины, терапевтические антитела или ингибиторы вирусных ферментов, заставили обратить внимание исследователей на геном самого человека. Если представить себе распределение признака восприимчивости к ВИЧ-инфекции в виде Гауссовой кривой (наиболее универсальный тип распределения параметров и признаков в живых системах), то на концах графика окажутся наиболее восприимчивые и наиболее устойчивые к ВИЧ индивидуумы.

Результаты клинических исследований полностью подтверждают приведенную гипотезу о нормальном распределении признака чувствительности к ВИЧ-инфекции. Действительно незначительная часть ВИЧ-инфицированных характеризуется ускоренным развитием заболевания (Jansen, Piriou et al. 2004, Meissner, Duus et al. 2004 Clark, Saag et al. 1991).

Однако наиболее интересным с точки зрения взаимоотношений человека и вируса является тот факт, что у небольшой части ВИЧ-инфицированных людей, никогда не получавших лечение, клинические симптомы заболевания отсрочены по времени или не развиваются вовсе (Sheppard, Lang et al. 1993, Migueles, Laborico et al. 2002). В ряде когортных исследований к таким лицам применяют термин «нонпрогрессоры» (Long-term non-progressors), отражающий статус этих лиц в отношении скорости развития (прогрессирования) ВИЧ-инфекции в СПИД. По оценкам американских исследователей (в России подобные исследования до сих пор не велись или носили эпизодический характер) они составляют около 0,5% от общего числа ВИЧ-инфицированных. По всей видимости, иммунная система этих людей обладает особенностями, которые позволяют им контролировать инфекцию на протяжении длительного времени (Haynes, Pantaleo et al. 1996).



Pages:     | 1 |   ...   | 2 | 3 || 5 | 6 |   ...   | 8 |

Похожие работы:

«МИНАЕВ АЛЕКСАНДР НИКОЛАЕВИЧ ПОВЕДЕНИЕ ЛОСЯ В УСЛОВИЯХ ДОМЕСТИКАЦИИ (биотелеметрическое исследование) Специальность 03.00.08 зоология Диссертация на соискание ученой степени кандидата биологических наук Москва 1992. -2ОГЛАВЛЕНИЕ Стр. Введение........... 3 Глава 1. Материал и методика....... 7 Глава 2. Система радиоопределения Лось-2 и оптимальные методы работы с...»

«БАБЕШКО Кирилл Владимирович ЭКОЛОГИЧЕСКИЕ ПРЕДПОЧТЕНИЯ СФАГНОБИОНТНЫХ РАКОВИННЫХ АМЕБ И ИХ ИСПОЛЬЗОВАНИЕ ДЛЯ РЕКОНСТРУКЦИИ ГИДРОЛОГИЧЕСКОГО РЕЖИМА БОЛОТ В ГОЛОЦЕНЕ Специальность 03.02.08 – экология (биология) диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: кандидат биологических наук Цыганов...»

«ХАПУГИН Анатолий Александрович РОД ROSA L. В БАССЕЙНЕ РЕКИ МОКША 03.02.01 – ботаника Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель Силаева Татьяна Борисовна д.б.н., профессор САРАНСК ОГЛАВЛЕНИЕ ВВЕДЕНИЕ Глава 1. ИСТОРИЯ ИЗУЧЕНИЯ РОДА ROSA L. В БАССЕЙНЕ МОКШИ. Глава 2. КРАТКАЯ ХАРАКТЕРИСТИКА РОДА ROSA L. 2.1. Характеристика рода Rosa L. 2.2. Систематика рода Rosa L. Глава 3....»

«Дандал Али Шебли ПАТОГЕНИТЕЧЕСКИЕ СВОЙСТВА ВИРУСА ИНФЕКЦИОННОГО БРОНХИТА КУР 06.02.02 «ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология» Диссертация на соискание ученой степени кандидата ветеринарных...»

«БРИТАНОВ Николай Григорьевич ГИГИЕНИЧЕСКИЕ АСПЕКТЫ ПЕРЕПРОФИЛИРОВАНИЯ ИЛИ ЛИКВИДАЦИИ ОБЪЕКТОВ ПО ХРАНЕНИЮ И УНИЧТОЖЕНИЮ ХИМИЧЕСКОГО ОРУЖИЯ 14.02.01 Гигиена Диссертация на соискание ученой степени доктора медицинских наук Научный консультант: доктор медицинских наук, профессор...»

«Мухаммед Тауфик Ахмед Каид ХАРАКТЕРИСТИКА ГЕНОТИПОВ С ХОРОШИМ КАЧЕСТВОМ КЛЕЙКОВИНЫ, ОТОБРАННЫХ ИЗ ГИБРИДНЫХ ПОПУЛЯЦИЙ АЛЛОЦИТОПЛАЗМАТИЧЕСКОЙ ЯРОВОЙ ПШЕНИЦЫ МЯГКОЙ С ИСПОЛЬЗОВАНИЕМ ДНК-МАРКЕРОВ Специальность 06.01.05 – селекция и семеноводство сельскохозяйственных растений Диссертация на соискание ученой степени кандидата сельскохозяйственных наук Научный...»

«АБДУЛЛАЕВ Ренат Абдуллаевич ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ МЕСТНЫХ ФОРМ ЯЧМЕНЯ ИЗ ДАГЕСТАНА ПО АДАПТИВНО ВАЖНЫМ ПРИЗНАКАМ Шифр и наименование специальности 03.02.07 – генетика 06.01.05 – селекция и семеноводство сельскохозяйственных растений ДИССЕРТАЦИЯ на соискание учёной степени кандидата...»

«Лёвкина Ксения Викторовна Влияние сроков, норм высева и удобрений на урожайность и качество зерна озимой твердой пшеницы в подзоне светло-каштановых почв Волгоградской области Специальность: 06.01.01 – общее земледелие, растениеводство Диссертация на соискание учёной степени кандидата сельскохозяйственных наук Научный...»

«ЯМБОРКО Алексей Владимирович ПОПУЛЯЦИОННАЯ ЭКОЛОГИЯ ЛЕСНЫХ ПОЛЕВОК (род CLETHRIONOMYS) СЕВЕРО-ВОСТОЧНОЙ АЗИИ Специальность 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук Н.Е. Докучаев Магадан – 2015 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ.. Глава 1. МАТЕРИАЛ И...»

«Очиров Джангар Сергеевич НАРУШЕНИЯ МИКРОНУТРИЕНТНОГО СТАТУСА ОВЕЦ И ИХ КОРРЕКЦИЯ ВИТАМИННО-МИНЕРАЛЬНЫМИ КОМПЛЕКСАМИ 06.02.01 – диагностика болезней и терапия животных, патология, онкология и морфология животных ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный руководитель: доктор ветеринарных...»

«РЫЛЬНИКОВ Валентин Андреевич ЭКОЛОГИЧЕСКИЕ ОСНОВЫ И ПОДХОДЫ К УПРАВЛЕНИЮ ЧИСЛЕННОСТЬЮ СИНАНТРОПНЫХ ВИДОВ ГРЫЗУНОВ (на примере серой крысы Rattus norvegicus Berk.) Специальность 03.00.16 – экология Диссертация на соискание ученой степени...»

«Ядрихинская Варвара Константиновна ЭКОЛОГИЧЕСКИЕ ОСОБЕННОСТИ РАСПРОСТРАНЕНИЯ ОСТРЫХ КИШЕЧНЫХ ИНФЕКЦИЙ В Г. ЯКУТСКЕ И РЕСПУБЛИКЕ САХА (ЯКУТИЯ) 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель кандидат биологических наук, доцент М.В. Щелчкова Якутск 2015...»

«Коротких Алина Сергеевна БИОЛОГИЧЕСКАЯ ХАРАКТЕРИСТИКА И СЕЛЕКЦИОННАЯ ОЦЕНКА ВИДОВ И СОРТОВ РОДА NARCISSUS L. В УСЛОВИЯХ ЮГО-ЗАПАДА ЦЧЗ (НА ПРИМЕРЕ БЕЛГОРОДСКОЙ ОБЛАСТИ) 06.01.05 – селекция и семеноводство сельскохозяйственных растений ДИССЕРТАЦИЯ на соискание ученой...»

«ПОЕДИНОК НАТАЛЬЯ ЛЕОНИДОВНА УДК 602.3:582.282/284:57.086.83]:[681.7.069.24+577.34 БИОТЕХНОЛОГИЧЕСКИЕ ОСНОВЫ ИНТЕНСИФИКАЦИИ КУЛЬТИВИРОВАНИЯ СЪЕДОБНЫХ И ЛЕКАРСТВЕННЫХ МАКРОМИЦЕТОВ С ПОМОЩЬЮ СВЕТА НИЗКОЙ ИНТЕНСИВНОСТИ 03.00.20 – биотехнология Диссертация на соискание научной степени доктора биологических наук Научный консультант Дудка Ирина...»

«Гилёв Андрей Николаевич ЛАТЕРАЛИЗАЦИЯ ФУНКЦИЙ ПЕРЕДНИХ КОНЕЧНОСТЕЙ У СУМЧАТЫХ (MAMMALIA: MARSUPIALIA) 03.02.04 – Зоология ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный руководитель: кандидат биологических наук, доцент Е. Б. Малашичев Санкт-Петербург – 2014 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ ГЛАВА 1. ОБЗОР...»

«ПОДОЛЬНИКОВА ЮЛИЯ АЛЕКСАНДРОВНА ОСОБЕННОСТИ СВОБОДНОРАДИКАЛЬНОГО СТАТУСА МОЛОКА КОРОВ УРБАНИЗИРОВАННОЙ ТЕРРИТОРИИ (НА ПРИМЕРЕ ОМСКОЙ ОБЛАСТИ) Специальность: 03.02.08 – экология ДИССЕРТАЦИЯ на соискание степени кандидата биологических наук Научный руководитель: Заслуженный работник высшей школы РФ доктор...»

«Палаткин Илья Владимирович Подготовка студентов вуза к здоровьесберегающей деятельности 13.00.01 общая педагогика, история педагогики и образования Диссертация на соискание ученой степени кандидата педагогических наук Научные руководители: доктор биологических наук, профессор,...»

«НГУЕН ВУ ХОАНГ ФЫОНГ ОЦЕНКА ЭКОЛОГИЧЕСКОЙ СИТУАЦИИ КРУПНЫХ ГОРОДОВ В СОЦИАЛИСТИЧЕСКОЙ РЕСПУБЛИКЕ ВЬЕТНАМ Специальность: 03.02.08экология (биология) Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель: доктор биологических наук, профессор Чернышов В.И. Москва ОГЛАВЛЕНИЕ ГЛАВА 1. ОБЩАЯ ХАРАКТЕРИСТИКА...»

«Цховребова Альбина Ирадионовна ВЛИЯНИЕ ФАКТОРОВ СРЕДЫ НА РАЗВИТИЕ БЕСХВОСТЫХ АМФИБИЙ СЕВЕРНЫХ СКЛОНОВ ЦЕНТРАЛЬНОГО КАВКАЗА Специальность 03.02.14 – биологические ресурсы Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель доктор биологических наук профессор Калабеков Артур Лазаревич Владикавказ 2015 Содержание Ведение..3 Глава I. Обзор литературных данных. 1.1....»

«Максимова Ольга Владимировна «Оценка микробиоты кишечника у детей с аллергическими заболеваниями в зависимости от массы тела» 03.02.03. – Микробиология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: Зверев Виталий Васильевич академик РАН, д.б.н., профессор Научный консультант: Гервазиева Валентина Борисовна д.м.н, профессор, заслуженный деятель науки РФ МОСКВА – 2015 Оглавление Список сокращений Введение Глава 1 Обзор литературы 1.1...»







 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.