WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 

Pages:   || 2 |

«ХАРАКТЕРИСТИКА ПАТОГЕННОСТИ ЕNTEROCOCCUS FAECALIS В УСЛОВИЯХ ДИСБАЛАНСА РЕДОКС-СИСТЕМЫ У ЖЕНЩИН С УРОГЕНИТАЛЬНЫМ ХЛАМИДИОЗОМ ...»

-- [ Страница 1 ] --

На правах рукописи

Красная Юлия Владимировна

ХАРАКТЕРИСТИКА ПАТОГЕННОСТИ ЕNTEROCOCCUS FAECALIS В

УСЛОВИЯХ ДИСБАЛАНСА РЕДОКС-СИСТЕМЫ У ЖЕНЩИН С

УРОГЕНИТАЛЬНЫМ ХЛАМИДИОЗОМ

03.02.03 – Микробиология

14.01.10 – Кожные и венерические болезни

Автореферат диссертации на соискание ученой степени

кандидата медицинских наук

Челябинск – 2015

Работа выполнена на кафедре общей и клинической фармакологии с курсом микробиологии и на кафедре инфекционных и кожно-венерических заболеваний Федерального государственного бюджетного образовательного учреждения высшего профессионального образования «Ульяновский государственный университет» Министерства образования и науки Российской Федерации

Научные руководители:

доктор медицинских наук, Потатуркина-Нестерова профессор Наталия Иосифовна доктор медицинских наук, Нестеров Алексей Сергеевич профессор

Официальные оппоненты:

Ворошилина Екатерина Сергеевна, доктор медицинских наук, доцент, Государственное бюджетное образовательное учреждение высшего профессионального образования «Уральский государственный медицинский университет» Министерства здравоохранения Российской Федерации, кафедра микробиологии, вирусологии и иммунологии, доцент Летяева Ольга Ивановна, доктор медицинских наук, Государственное бюджетное образовательное учреждение высшего профессионального образования «Южно-Уральский государственный медицинский университет» Министерства здравоохранения Российской Федерации, кафедра дерматовенерологии, профессор

Ведущая организация: государственное бюджетное образовательное учреждение высшего профессионального образования «Оренбургский государственный медицинский университет» Министерства здравоохранения Российской Федерации

Защита диссертации состоится «___»____________ 2015 года в____ часов на заседании диссертационного совета Д 208.117.03 при Государственном бюджетном образовательном учреждении высшего профессионального образования «Южно-Уральский медицинский университет» Министерства здравоохранения Российской Федерации (454092, г.

Челябинск, ул. Воровского, 64).

С диссертацией можно ознакомиться в научной библиотеке Государственного бюджетного образовательного учреждения высшего профессионального образования «ЮжноУральский медицинский университет» Министерства здравоохранения Российской Федерации (454092, г. Челябинск, ул. Воровского, 64) и на сайте www.chelsma.ru Автореферат разослан «___» ___________ 2015 года.

Ученый секретарь диссертационного совета, доктор медицинских наук Шишкова Юлия Сергеевна

ОБЩАЯ ХАРАКТЕРИСТИКА ДИССЕРТАЦИИ

Актуальность темы исследования и степень ее разработанности В последние годы проблема этиологической значимости условнопатогенных микроорганизмов, в том числе и энтерококков, в развитии инфекционных заболеваний становится все острее (Бондаренко В.М. «Острова»

патогенности бактерий // Журнал микробиологии. 2004. №4.С.67-74.). Установлено, что представители рода Enterococcus занимают одну из лидирующих позиций в качестве причины нозокомиальных и оппортунистических инфекций. В 10-20% случаев энтерококки выделяют из гноя интраабдоминальных абсцессов, в 8-14% – случаях – при раневых нозокомиальных инфекциях (НКИ), в 30% случаев при постгемодиализной бактериемии и при инфекциях мочевыводящих путей (Валышева И.В. Генетическая характеристика вирулентного потенциала энтерококков кишечной микробиоты человека// Журнал микробиологии, эпидемиологии и иммунобиологии.2012. №4. С.44- 48.).

Среди аэробных грамположительных микроорганизмов энтерококки занимают первое место при хирургических инфекциях (Asghar A.H. Frequency and antibiotic susceptibility of gram-positive bacteria in Makkah hospitals// Ann.Saudi.Med. 2011. V.31. №5. P.462-468.). В РФ энтерокковые инфекции приобрели характер серьезной медико-социальной проблемы. Масштабы этой патологии и огромный экономический ущерб еще не изучены и не осознаны в полном объеме (Вершинин А.Е. Генетическая идентификация как способ выявления патогенных и симбиотических штаммов энтерококков // Журнал микробиологии. 2008. №5. С.50-53.). Обнаружение у больного энтерококков часто ставит неразрешимые вопросы перед клиницистами в плане определения врачебной тактики (Бондаренко В.М., Суворов А.Н. Симбиотические энтерококки и проблемы энтерококковой оппортунистической инфекции // Журнал микробиологии. 2008. №3. С.14-27.).

Известно, что тяжесть течения энтерококковой инфекции, как и всех других, вызванных условно-патогенными возбудителями, зависит, с одной стороны, от наличия факторов патогенности у микроорганизма, с другой стороны, от состояния иммунного статуса макроорганизма (Долгушин И.И. Роль нейтрофилов в формировании микробиоценоза слизистых оболочек // Вестник новых медицинских технологий. 2009. Т. XVI, №1. С.20-22.). Выявлены различия в степени выраженности патогенных свойств возбудителя в моно - и микстинфекциях (Бухарин О.В. Роль доминантной микрофлоры в механизмах защиты вагинального биотопа женщин // Журнал микробиологии, эпидемиологии и иммунобиологии. 2013. №6. С.100-105.).

Согласно данным ВОЗ (2007) урогенитальный хламидиоз (УГХ) является одним из самых распространенных заболеваний, передаваемых половым путем. Ежегодно в мире регистрируется около 100 миллионов новых случаев хламидийной инфекции (Позняк А.Л, Сидорчук С.Н., Захаркин Ю.Ф. Терапия хронической трихомонадной инвазии у больных с микст-хламидийной мочеполовой инфекцией // Журнал инфектологии. 2009.Т.1. №4. С.60-65.). Для возбудителя урогенитального хламидиоза доказана этиологическая роль в развитии острых и хронических заболеваний различной локализации с большим спектром осложнений. Однако роль C. trachomatis в инфекционной патологии человека еще не оценена в должной мере (Перепанова Т.С. Неосложненная инфекция мочевых путей // Consilium–medicum. 2003.№5.С.1-4;

Mayaud P. Approaches to the control of sexually transmitted infections in developing countries: old problems and modern challenges // Sexually Transmitted Infections. 2004. Vol.80. Р.174-182.).

Носительство хламидий приводит к развитию таких патологических состояний как аутоиммунные реакции, хромосомные аберрации, способствует возникновению смешанных хламидийно-вирусных и хламидийнобактериальных инфекций (Серов В.Н., Баранов И.И. Лечение урогенитальных инфекций у женщин в современных условиях // РМЖ «Акушерство и гинекология». 2004. Т.12, №8. С.135-141.). Урогенитальный хламидиоз является одной из главных предотвратимых причин бесплодия, особенно среди женщин (Рудакова Е.Б., Семенченко С.И., Панова О.Ю. Инфекционная патология нижнего отдела половых путей женщины и бесплодие (обзор литературы) // Гинекология. 2004. Т.6. №3. С.132-136; Haggerty C.L. Epidemiology, pathogenesis and treatment of pelvic inflammatory disease // Expert Review of AntiInfective Therapy. 2006. N4. Vol.2. Р.235-247.).

Установлено, что урогенитальный хламидиоз характеризуется высоким удельным весом микст-инфекций (Введенская Э.В., Абайтова Н.Е. Распространенность специфических и неспецифических воспалительных заболеваний урогенитального тракта // Тезисы научных работ I Российского конгресса дерматовенерологов. СПб., 2003. Т.1. С.99.). Так, по данным В.А. Лебедева и А.И. Давыдова (Лебедев В.А., Давыдов А.И. Урогенитальный хламидиоз // Вопросы гинекологии, акушерства и перинатологии. 2012. №1(2). С.25-31) хламидийная моноинфекция наблюдается только у 2-20% пациентов. Показано, что важным кофактором развития патологического процесса в урогенитальном тракте женщин является микробиота данного биотопа, в связи с чем при диагностике урогенитальных инфекций следует обращать внимание на наличие и персистентность сопутствующих условно- патогенных бактерий (Шварцкова Т.А., Цыганко Е.В. Частота встречаемости Chlamydia trachomatis, Mycoplasma hominis и Ureaplasma urealyticum в Екатеринбурге // Генодиагностика инфекционных болезней: сборник тезисов V Всероссийской научно – практической конференции. М., 2004. Т.2. С.18-20.; Гончарова Н.Н.

Особенности фетоплацентарного комплекса при беременности, осложненной хроническим урогенитальным хламидиозом: автореф. дис. канд. мед. наук:14.00.01 / Н.Н. Гончарова. Томск, 2006. 19 С.; Мотавкина Н.С. Бушуева Е.Н. Биоценоз условно-патогенных бактерий и возбудителей урогенитальных инфекций передающихся половым путем, в генезе гуморальных иммунодефицитов // Тихоокеанский медицинский журнал. 2006. №3. С.40-42.). В то же время данный вопрос при урогенитальном хламидиозе остается открытым.

В последние годы все больше исследователей наряду с классическими общепринятыми механизмами развития воспаления признают роль свободнорадикальных кислородных и липидных процессов редокс-системы («redoxoxidation-reduction system» – окислительно-восстановительная система) в патогенезе многих заболеваний. Нарушение редокс-баланса приводит к возникновению окислительного стресса, ключевым событием которого является гиперпродукция активных форм кислорода (Меньщикова Е.Б., Ланкин В.З.,

Зенков Н.К. Окислительный стресс. Прооксиданты и антиоксиданты/М.:

«Слово», 2006. 556 С.). Изменение равновесия между процессами перекисного окисления липидов и антиоксидантной активности приводит к необратимым повреждениям молекул липидов, белков, нуклеиновых кислот и, в конечном счете, к гибели клеток (Жаворонок Т.В., Носырева О.Л., Помогаева А.П. Механизмы антиперекисной защиты и система глутатиона при острой иерсиниозной инфекции // Эпидемиология и инфекционные болезни. 2006.

№2. С.28-32.; Padayatty S.J. Vitamin C as an Antioxidant: Evaluation of Its Role in Disease Prevention // Journal of the American College of Nutrition. 2003.

Vol.22. Р.18-35.;Halliwell, B. Oxygen toxiciti, oxygen radicals, transition metals and disease // Biochemistry. 2004. Vol.215. Р.1-14.). При чрезмерной выраженности этого процесса возможно местное повреждение тканей и развитие системных эффектов (Жаворонок Т.В., Носырева О.Л., Помогаева А.П. Механизмы антиперекисной защиты и система глутатиона при острой иерсиниозной инфекции // Эпидемиология и инфекционные болезни. 2006. №2. С.28Padayatty S.J. Vitamin C as an Antioxidant: Evaluation of Its Role in Disease Prevention // Journal of the American College of Nutrition. 2003. Vol.22. Р.18-35.;

Halliwell B. Oxygen toxiciti, oxygen radicals, transition metals and disease // Biochemistry. 2004. Vol.215. Р.1-14.).

В литературе накоплено достаточно сведений о том, что образование свободных радикалов является одним из универсальных патогенетических механизмов при различных типах повреждения: воспалении, старении, канцерогенезе, химическом, лекарственном и радиоактивном повреждении тканей, атерогенезе, кислородной и озоновой токсичности (Журавлева Т.Д., Суплотов С.Н. Возрастные особенности свободнорадикального окисления липидов и антиоксидантной защиты в эритроцитах здоровых // Вопросы медицинской химии. 2003. №5. С.17-18.; Воскресенский С.К., Жутаев И.А. Антиоксидантная система, онтогенез и старение// Вопросы медицинской химии. - 2004. С.14-27.; Klebanoff S.J. Myeloperoxidase: role in neutrophil – mediated toxicity // Molecular Biology and Infectious Diseases. 2006. Vol.24. Р.283-289.).

Однако роль-редокс-системы в патогенезе урогенитального хламидиоза в условиях изменения патогенного потенциала микробного консорциума урогенитального тракта до сих пор остается мало изученной.

Исследователями, изучающими микробные сообщества, не в полной мере изучено изменение видового спектра и патогенности сопутствующей микробиоты урогенитального тракта у больных урогенитальным хламидиозом и роль редокс-системы в этиопатогенезе урогенитального хламидиоза в условиях изменения патогенного потенциала микробного консорциума урогенитального тракта. Не установлена степень деструкции клеточных мембран и уровень регуляторных белков (R- белков) при урогенитальном хламидиозе.

Цель исследования Изучить патогенность клинических изолятов Enterococcus faecalis и состояние редокс-системы у женщин с урогенитальным хламидиозом.

Задачи исследования Дать характеристику клинико-лабораторных проявлений урогенитального хламидиоза у женщин.

Выявить особенности видового состава и колонизационной резистентности микробиоты репродуктивного тракта женщин, больных урогенитальным хламидиозом.

Определить частоту встречаемости генетических детерминант патогенности у штаммов Enterococcus faecalis, выделенных из репродуктивного тракта женщин, больных урогенитальным хламидиозом.

Провести сравнительное изучение редокс-системы, а также связанных с ней степени деструкции клеточных мембран и состояния иммунитета в группах больных урогенитальным хламидиозом при наличии и отсутствии в микробном консорциуме репродуктивного тракта Enterococcus faecalis с повышенным патогенным потенциалом.

Методология и методы исследования В основу диссертационного материала положен принцип изучения и анализа фактического материала. Для достижения поставленной цели диссертации и решения задач исследования в работе использовали следующий комплекс методов: клинический, инструментальный, лабораторный, аналитический и статистический. Методики исследования, состоящие из нескольких этапов с использованием соответствующих методов исследования, подробно изложены во второй главе диссертации.

Степень достоверности, апробация результатов и личное участие автора Достаточный массив фактических данных, избранный дизайн и методы исследования, адекватные сформулированным в работе целям и задачам, корректный и разносторонний статистический анализ обеспечили достоверность полученных результатов, сформулированных выводов, положений и рекомендаций.

Диссертация выполнена в соответствии с планом научной работы ФГБОУ ВПО «Ульяновский государственный университет», регистрационный номер 01201178149 «Механизмы развития инфекций, передаваемых половым путем при участии симбионтной микрофлоры».

Основные положения работы доложены на 47-й межрегиональной научнопрактической конференции «Артериальная гипертония: ретроспектива и современность. Проблемы выживаемости в 21 веке» (г. Ульяновск, 2012), на VIII международной научно-практической конференции «Дни науки – 2012»

(Чешская Республика, г. Прага), на Российской конференции с международным участием «Высшее сестринское образование в системе Российского здравоохранения» (г. Ульяновск, 2012), 48-й межрегиональной научнопрактической медицинской конференции медицинских работников (посвященная 70-летию образования Ульяновской области) «Наука и медицина XXI века: традиции, инновации, приоритеты» (Ульяновск, 2013), 49-й Межрегиональной научно-практической медицинской конференции «Медицина и современность. Теория, практика, перспективы» (Ульяновск, 2014).

Личный вклад автора состоит в непосредственном участии на всех этапах диссертационного исследования. Тема и план диссертации, ее основные идеи и содержание разработаны совместно с научными руководителями на основании целенаправленных исследований. Автор принимал непосредственное участие в клиническом обследовании больных и в лабораторных исследованиях. Лично проводил оценку клинического течения урогенитального хламидиоза, а также результатов бактериологических и молекулярно-генетических исследований. Автором подробно исследованы активность редокс-системы, особенности микробиоценоза урогенитального тракта у больных УГХ, генетические детерминанты факторов патогенности клинических изолятов Е.

faecalis. Автором самостоятельно сформирована база данных и проведено обобщение полученных результатов. Материал был обработан с помощью современных методов статистического анализа.

Положения, выносимые на защиту У 61,5% пациенток урогенитальный хламидиоз, вызванный 1.

Chlamydia trachomatis, выявлен в виде моноинфекции, у 38,5% – в сочетании с возбудителями других инфекций, передающихся преимущественно половым путем. Воспалительные заболевания репродуктивного тракта женщин, вызванные C. trachomatis, в большинстве случаев (51,6% обследованных) протекают бессимптомно. Однако при объективном осмотре у большинства обследованных выявлены неспецифические клинические признаки воспалительного процесса – серозно-гнойные выделения (58,8%), гиперемия и отек слизистой оболочки наружного отверстия уретры (40,1%), отечность и гиперемия слизистой оболочки шейки матки 29,7%.

Урогенитальный хламидиоз у женщин сопровождается расширением видового спектра патогенных и условно-патогенных представителей микробного консорциума урогенитального тракта с доминированием условно

- патогенного вида Enterococcus faecalis на фоне сокращения нормофлоры (Lactobacillus spp.) и повышением количественных показателей трудно- и некультивируемых видов.

При урогенитальном хламидиозе происходит повышение уровня 3.

патогенности клинических изолятов Enterococcus faecalis, что проявляется достоверным увеличением числа особей с нуклеотидными последовательностями генов, детерминирующие экспрессию факторов патогенности: еsр (адгезия, колонизация), сylmА (активация цитолизина) и asa (поверхностный белок-адгезин).

При урогенитальном хламидиозе отмечается дисбаланс редокссистемы, проявляющийся повышением липопероксидации в тканях и повреждением клеточных мембран. Изменения в системе перекисное окисление липидов – антиоксидантная система сопровождается нарушением клеточного, гуморального, цитокинового звеньев иммунитета и системы фагоцитоза. Выявленные изменения способствуют реализации патогенного потенциала условно-патогенных представителей микробного консорциума урогенитального тракта, в частности Enterococcus faecalis и оказывают влияние на течение и исход заболевания.

Научная новизна работы Впервые показано, что при урогенитальном хламидиозе происходит повышение уровня патогенности условно-патогенного представителя микрофлоры урогенитального тракта – E. faecalis, что проявляется достоверным увеличением числа особей с нуклеотидными последовательностями генов еsр (адгезия, колонизация), asa (поверхностный белок-адгезин) и сylmА (активация цитолизина, бактериоциногенность), детерминирующими экспрессию факторов патогенности. У пациенток с урогенитальным хламидиозом выявлены основные направления изменений микробного консорциума, проявляющиеся в расширении видового спектра и частоты встречаемости патогенных и условно-патогенных видов (с доминированием условно-патогенного микросимбионта Е. faecalis) на фоне сокращения нормофлоры урогенитального тракта.

Впервые установлено, что в эритроцитах и плазме крови больных урогенитальным хламидиозом происходит активация свободнорадикальных процессов, сопровождающаяся снижением содержания антиокислительных факторов, способствующих высвобождению токсинов и медиаторов воспаления.

Полученные результаты свидетельствуют о патогенетической роли дизрегуляции редокс-системы в деструкции клеточных мембран у больных УГХ, что подтверждается выявленной сильной положительной достоверной корреляционной взаимосвязью между уровнем МДА и R-белков у обследованных больных, особенно при урогенитальном хламидиозе, характеризующимся повышением патогенности энтерококков (r=+0,82; р=0,031).

Получены новые данные об иммунологической перестройке у обследованных женщин при урогенитальном хламидиозе. Выявлен выраженный дисбаланс клеточного и гуморального звеньев иммунной системы, а также цитокинового профиля, что способствует реализации патогенного потенциала условно-патогенного компонента микробного консорциума урогенитального тракта, в частности E. faecalis и хронизации воспалительного процесса.

Теоретическая и практическая значимость работы В теоретическом плане результаты исследования показывают усиление патогенного потенциала E. faecalis у больных УГХ. Выявленный дисбаланс редокс-системы у пациенток с урогенитальным хламидиозом при выявлении энтерококков с высоким патогенным потенциалом в урогенитальном тракте сопровождается активацией деструкции мембран клеток. При этом развивается дисбаланс клеточного и гуморального звеньев иммунной системы.

В практическом плане возможна оптимизация диагностики и повышения эффективности лечебных мероприятий при УГХ путем внедрения в работу лабораторий кожно-венерологических диспансеров бактериологического и молекулярно-генетического исследования материала из половых путей для обнаружения факторов патогенности с целью последующего назначения этиотропного лечения.

Обнаруженный дисбаланс редокс-систем при УГХ позволяет использовать определение показателей перекисного окисления липидов и антиоксидантной защиты, а также R-белков для характеристики степени тяжести заболевания, прогноза течения и оценки эффективности проводимого лечения.

Внедрение результатов исследования в практику Разработано и внедрено в практику комплексное клинико-лабораторное обследование больных УГХ, включающее изучение патогенного потенциала микрофлоры урогенитального тракта и активности редокс-системы для оценки тяжести и прогнозирования течения заболевания, а также эффективности лечения (Акт о внедрении от 12 сентября 2013 г., выдан ГУЗ «Областной клинический кожно-венерологический диспансер» г. Ульяновска).

Материалы работы используются в диагностической и лечебной работе ГУЗ «Областной клинический кожно-венерологический диспансер» г. Ульяновска (Акт о внедрении от 12 сентября 2013 г.) и внедрены в учебнопедагогический процесс преподавания дерматовенерологии и микробиологии студентов медицинского и педиатрического факультетов, а также клинических ординаторов и интернов факультета последипломного образования и научно-исследовательской лаборатории ФГБОУ ВПО «Ульяновский государственный университет» (Акт о внедрении от 01 октября 2013 г.).

Издана монография для врачей, интернов и ординаторов, студентов медицинских вузов «Роль редокс-системы в патогенезе урогенитального хламидиоза» (г. Ульяновск: УлГУ, 2013). Изданы практические рекомендации для врачей, интернов и ординаторов, студентов медицинских вузов «Клиникодиагностическое значение редокс-системы при урогенитальном хламидиозе у женщин» (г. Ульяновск: УлГУ, 2013).

Публикации Соискатель имеет 15 опубликованных работ, из них по теме диссертации опубликовано 14 научных работ общим объемом 8,78 печатных листов, в том числе 5 публикаций (5 статей) в научных журналах и изданиях, которые включены в перечень российских рецензируемых научных журналов и изданий для опубликования основных научных результатов диссертаций. Соискателем опубликованы 6 работ в материалах межрегиональных, всероссийских и международных конференций, 1 статья в международном журнале, 1 монография, изданы 1 практические рекомендации.

Структура и объем диссертации Диссертационная работа изложена на 164 страницах. Состоит из введения, обзора литературы, 6 глав собственных исследований, заключения, выводов и списка литературы. Библиография содержит 273 источника, из них 199 отечественных и 74 иностранных. Работа иллюстрирована 28 таблицами и 18 рисунками.

ОСНОВНОЕ СОДЕРЖАНИЕ ДИССЕРТАЦИИ

Характеристика материала и методов исследования Работа выполнена в ФГБОУ ВПО «Ульяновский государственный университет» в период 2010-2014 гг. На первом этапе был проведен скрининг 296 женщин, больных урогенитальным хламидиозом, находившихся на лечении в ГУЗ «Областной клинический кожно-венерологический диспансер» г. Ульяновска. Средний возраст обследованных составил 29,6±1,2 года. Из всех обследованных у 114 больных УГХ (38,5%) были обнаружены сопутствующие возбудители урогенитальных инфекций. Такие пациентки были исключены из исследования. Критериями исключения из исследования являлись воспалительные заболевания органов малого таза, бесплодие, прием антибактериальных и гормональных препаратов.

В дальнейшие исследования были включены 182 (61,5%) пациентки с диагнозом «Хламидийная инфекция нижних отделов мочеполового тракта (А56.0)», которые составили основную группу обследованных (рисунок 1).

Диагноз ставили в соответствии с Клиническими рекомендациями «Ведение больных инфекциями, передаваемыми половым путем, и урогенитальными инфекциями» (РОДВК, Москва, 2013).

На следующем этапе исследования у 78 (42,9%) пациенток, из 182 женщин основной группы, в репродуктивном тракте были выявлены Enterococcus faecalis (первая группа), у 104 пациенток (57,1%) энтерококки не были выявлены (вторая группа). Группу сравнения составили 52 практически здоровых женщины, репрезентативных по возрасту. Все обследования проводили с письменного согласия пациенток.

В работе использовали штаммы Enterococcus faecalis, выделенные у 78 обследованных пациенток с диагнозом «Хламидийная инфекция нижних отделов мочеполового тракта». Исследуемый материал из цервикального канала и заднего свода влагалища забирали стерильным одноразовым зондом фирмы «НПФ ЛАБдиагностика». Взятый материал в объеме 0,1 мл секрета переносили в пробирки с 0,9 мл транспортной среды и доставляли в лабораторию в течение часа с момента забора материала.

Для получения чистых культур использовали Энтерококк агар (НПЦ, г.

Оболенск) с последующим накоплением культуры на Columbia agar (Bio-Rad, Франция) с кровью и идентификацией на среде Diskinson Oxoid (Himedia, Индия). При выполнении ПЦР с целью выявления генетических детерминант патогенности энтерококков использовали штамм Enterococcus faecalis №111, полученный из музея культур Института клеточного и внутриклеточного симбиоза УрО РАН (г. Оренбург).

Дизайн исследования включал: характеристику клинико-лабораторных данных больных; выявление бактериального пейзажа репродуктивного тракта; оценку окислительно-антиоксидантной системы; характеристику иммунологического статуса; статистическую обработку полученных данных.

Всем больным для диагностики УГХ и сопутствующих урогенитальных инфекций проводили комплексное обследование, включавшее: клиническое (сбор анамнеза, клинико-визуальное исследование), инструментальное обследование (расширенная кольпоскопия); молекулярно-генетический анализ (PCR real-time), позволяющий типировать ДНК возбудителя заболевания и выявлять нуклеотидные последовательности генетических детерминант патогенности; а также бактериологические, серологические, биохимические, иммунологические и общеклинические исследования.

В исследуемом материале выявляли возбудителей и антитела к ним при помощи прямого ИФА и ПЦР в реальном времени (PCR real-time), с использованием диагностического комплекса «QIAGEN» (Rotor-Gene, Германия). С целью идентификации возбудителей сопутствующих ИППП применяли культуральный, серологические методы и PCR real-time.

Состояние вагинального микроценоза, количественную и качественную оценку его состава производили методом секторального посева, выражая степень колонизации в КОЕ/мл. Для количественной оценки трудно- и некультивируемых видов проводили PCR real-time с использованием амплификатора ДТ-96 (ООО «НПО ДНК-технология, Россия) и комплекта реагентов Фемофлор 16 (ООО «НПО ДНК-технология, Россия). Исследование позволяло определять общую бакмассу в пробе, нормофлору, облигатно-анаэробные микроорганизмы, дрожжеподобные грибы и микоплазмы.

Выявление нуклеотидных последовательностей генов, детерминирующих экспрессию факторов патогенности E. faecalis, еsр (адгезия, колонизация), asa (поверхностный белок-адгезин) и сylmА (активация цитолизина) проводили при помощи PCR real-time. В качестве контроля использовали штамм Enterococcus faecalis №111, полученный из музея культур Института клеточного и внутриклеточного симбиоза УрО РАН (г. Оренбург). Выделение ДНК энтерококков проводили с использованием гуанидинтиоцианата (GuSCN). Подбор праймеров и температуры отжига осуществляли с использованием пакета программ в Gene Runner Version 3.05 и Primer Blast (ресурсы GeneBank) (США). Праймеры энтерококков были синтезированы в «ООО Синтол» (Москва) (таблица 1).

Таблица 1 – Использованные в работе праймеры № Гены Последовательность ДНК Размер амплип/п патогенности праймеров (5' to 3' ) кона (н.п.) еsр

1 f TGGCTACTGCTAGTCCAGGACC

(адгезия, колонизация) r GCGTCAAGACTTGCATCGCCGA

–  –  –

r CCTGTCGCAAGATCGACTGTA

белок-адгезин) Активность редокс-системы определяли по уровню малонового диальдегида (МДА), супероксиддисмутазы (СОД), глутатионредуктазы (ГР) и каталазы в плазме крови и гемолизате эритроцитарной массы. МДА изучали в тесте с тиобарбитуровой кислотой (ТБК). Активность СОД выявляли тестом с нитросиним тетразолием (НСТ). Об активности каталазы судили по интенсивности утилизации перекиси водорода и скорости снижения экстинкции при длине волны 260 нм, на которой перекись водорода имеет максимум светопоглощения. Определение активности ГР проводили на спектрофотометре СФпри длине волны 340 нм против воды (Агарков А.А. Регуляция активности глутатионредуктазы из печени крысы при токсическом гепатите и действии гепатопротекторов: автореф. дис. … канд. биол. наук: 03.00.04 / Агарков Александр Алексеевич. Воронеж, 2009. 24 С.).

Для характеристики катаболических процессов мембран клеток производили определение в периферической крови R-белка в РТГА между анти Rсывороткой и эритроцитами человека (Родионова Г.Б., Герасименко В.В. Методы физиолого-биохимических исследований крови// Оренбург: Издательский центр ГНУ ВНИИМС, РАСХН, 2005. 148 С.). Для определения количества лейкоцитов и лимфоцитов в периферической крови применялся автоматический гематологический анализатор (Cell-Dyn 3700). Мембранные маркеры субпопуляций лимфоцитов (CD3+, CD4+, CD8+, CD16+, CD19+ лимфоциты) определяли с помощью моноклональных антилимфоцитарных антител в реакции непрямой иммунофлуоресценции (Козинец Г.И. Клетки крови: современные технологии их. М.: «Триада-Фарм»,2002.451 С.). Для этого использовали диагностикумы ООО «Сорбент» для проточного цитометра (фитц-меченные моноклональные антитела).

Функциональную активность лейкоцитов определяли при помощи фагоцитарной реакции полиморфноядерных лейкоцитов (ПМЯЛ), РТМЛ, РБТЛ.

Аффинность Т-лимфоцитов (Еа-РОК) оценивали методом спонтанного розеткообразования с эритроцитами барана (Галактионов В.Г. М.: Издательский центр «Академия», 2004. 528 С.). Активность В-лимфоцитов определяли по концентрации ЦИК (Самойлова Р.С., Булычева Т.И. Иммунофенотипирование в диагностике хронических лимфоидных // Клиническая лабораторная диагностика. 2003. №11. С.35-39.), уровню сывороточных иммуноглобулинов (A, M, G); Ig Е методом ИФА.

Количественное определение уровня цитокинов проводили методом твердофазного ИФА с использованием тест-систем «Цитокиновый контур» (г.

Санкт-Петербург), «Вектор-Бест» (г. Новосибирск). При изучении спонтанной и индуцированной способности лейкоцитов крови секретировать IL-1, IL-1, IL-2, IL-4, IL-6, IL-8, IL-10, фактор некроза опухоли- (ФНО-), - и IFN в качестве мутагена использовали ФГА, учет результатов проводили на анализаторе «УНИПЛАН» АИФР-01 фирмы «ПИКОН» (Г.А. Зайцева и соавт., Цитокиновый статус доноров крови и ее // Фундаментальные исследования.

2011. №3. С.61-65.).

Для оценки полученных данных использовали описательные методы статистики, корреляционный анализ, параметрические и непараметрические методы (Медков В.М. Демография: серия «Учебники и учебные пособия»

Ростов на Дону: Феникс, 2002. 448 С.). Статистическую обработку полученных экспериментальных данных проводили с определением t-критерия Стьюдента, с использованием пакета программ Statistica 6.0. Оценку достоверности полученных результатов, не подчиняющихся закону нормального распределения, проводили с использованием непараметрического метода – определения критерия по Манну-Уитни. Различия считали достоверными при уровне статистической значимости p0,05. Для оценки значимости малых по объему выборок применяли критерий Фишера. Для выявления связи между отдельными признаками использовали коэффициент корреляции (r).

Результаты исследований и их обсуждение Из 182 обследованных женщин 51,6% (94 женщины) не предъявляли жалоб, характерных для воспалительных процессов в урогенитальном тракте (рисунок 1).

Только 82 обследованные женщины (48,4%) отмечали незначительные субъективные симптомы, наиболее частыми из которых являлись:

чрезмерная влажность половых органов (76 обследованных), зуд и жжение в области урогенитального тракта (58 женщин), частые позывы к мочеиспусканию (42 пациентки), скудные слизистые выделения (39 женщин) и боли при мочеиспускании.

–  –  –

При объективном осмотре у 91,8% женщин (167 человек) были выявлены признаки воспаления в урогенитальном тракте, и только у 15 пациенток (8,2%) отсутствовали какие-либо изменения в нижних и верхних отделах мочеполовой системы. Из всех клинических проявлений урогенитального хламидиоза наиболее часто встречались серозно-гнойные выделения (58,8%), гиперемия и отек слизистой оболочки наружного отверстия уретры (40,1%), отечность и гиперемия слизистой оболочки шейки матки 29,7%.

Лабораторным критерием, подтверждающим наличие уретрита у женщин, являлось обнаружение 5 и более полиморфноядерных лейкоцитов (ПМЯЛ) в поле зрения в мазках из уретры, 10 и более (ПМЯЛ) в цервикальном канале при просмотре более 5 полей зрения при увеличении микроскопа 10х1000 (Молочков В.А. Современный взгляд на патогенез и лечение персистирующей и хронической хламидийной урогенитальной инфекции// Российский журнал кожных и венерических болезней. 2008. №2. С.61-64.).

Проведенные исследования выявили существенные отличия интенсивности роста микробиоты урогенитального тракта у здоровых женщин и у пациенток с УГХ. Установлено, что более половины здоровых женщин имело скудную микробиоту и лишь три – обильную. Среди обследованных основной группы, напротив, почти половина пациенток имела обильную микробиоту.

Изучение микробиоценоза вагинального и цервикального биотопов больных УГХ выявило ее значительные изменения – снижение показателей частоты встречаемости и колонизационной плотности нормофлоры (Lactobacillus spp.) на фоне повышения указанных показателей у представителей условнопатогенной и патогенной микробиоты репродуктивного тракта (таблица 2).

–  –  –

Наиболее часто встречающимся видом при дисбиотических нарушениях микробиоценоза влагалища, развивающихся при УГХ, являлся условнопатогенный вид Enterococcus faecalis. Установлено, что энтерококки обнаруживались почти в два раза чаще, чем у здоровых. Показатель микробной обсемененности Е. faecalis увеличивался во влагалище в 2,0 раза (8,13±1,64 lg КОЕ/мл и 4,08±1,12 lg КОЕ/мл соответственно, р0,05), а в цервикальном канале – в 2,2 раза (4,85±0,93lg КОЕ/мл и 2,17±0,68 lg КОЕ/мл соответственно, р0,05).

Исследование биоценоза урогенитального тракта пациенток с УГХ (PCR real-time) на наличие трудно- и некультивируемых видов выявило увеличение показателей общей бактериальной массы и содержания факультативноанаэробных и облигатно-анаэробных бактерий. Наиболее частыми представителями данной микрофлоры являлись Gardnerella vaginalis/ Prevotella bivia/Porphyromonas spp.; Eubacterium spp.; Sneathia spp./ Leptotrichia spp./Fusobacterium spp.; Lachnobacterium spp./Clostridium spp.; Megasphaera spp./ Veilonella spp./ Dialister spp.; Atopobium vaginae.

С целью изучения патогенных свойств энтерококков, выделенных у женщин, проводили выявление генетических детерминант патогенности: еsр (адгезия, колонизация), asa (поверхностный белок-адгезин) и сylmА (активация цитолизина). Далее, используя набор указанных ранее праймеров, было проведено сравнительное определение нуклеотидных последовательностей генов, детерминирующих экспрессию факторов патогенности энтерококков у больных УГХ (первая группа) и здоровых женщин. У штаммов E. faecalis первой группы установлено статистически значимое увеличение количества особей, в генотипе которых локализованы указанные нуклеотидные последовательности (таблица 3).

–  –  –

Определение активности редокс-системы показало, что у пациенток с УГХ происходило повышение уровня ферментов системы ПОЛ, наиболее выраженное у больных первой группы. Так, значения МДА достоверно возрастали по сравнению со здоровыми женщинами в эритроцитах (рисунок 2).

1318,9*/•

–  –  –

* – показатель достоверности между больными УГХ и здоровыми (p10,05);

• – показатель достоверности между больными УГХ с энтерококками и без (p20,05) Рисунок 2 – Уровень МДА в эритроцитах обследованных (мкмоль/л) Важным элементом неферментативной подсистемы антиоксидантной защиты организма являются белки плазмы крови, из которых антиоксидантный эффект наиболее выражен у альбумина и -глобулинов (Куликова А.И. Методические аспекты оценки потенциальной способности липидов к перокислению по уровню ТБК-активных продуктов сыворотки крови при стимуляции ионами железа // Клиническая лабораторная диагностика. 2008. №5. С.8Установлено, что у пациенток с УГХ формировалась диспротеинемия с уменьшением содержания альбуминов, особенно выраженная при наличии энтерококков в урогенитальном тракте женщин – 59,6±6,1% (в группе сравнения 70,1±4,7%; р0,05). Наблюдалось также незначительное повышение уровня -глобулинов (р0,05) и статистически значимое увеличение 2глобулинов до 14,2±2,1% (р0,05), принимающих участие в окислении Fe2+ в Fe3+, что свидетельствует об изменении процессов перекисного окисления липидов у больных УГХ, особенно при выявлении вирулентных энтерококков.

Далее проводили определение ферментативной подсистемы защиты, включающей супероксиддисмутазу (СОД), каталазу, глутатионпероксидазу (ГП), глутатионредуктазу (ГР) и др. Все они катализируют реакции, в результате которых токсичные свободные радикалы и перекиси превращаются в нетоксичные соединения (Куликова А.И. Методические аспекты оценки потенциальной способности липидов к перокислению по уровню ТБК-активных продуктов сыворотки крови при стимуляции ионами железа // Клиническая лабораторная диагностика. 2008. №5. С.8-10.). Установлен дефицит СОД, являющейся одним из ключевых ферментов антирадикальной защиты. Снижение активности СОД в плазме крови и эритроцитах периферической крови у больных УГХ свидетельствует о декомпенсации антиоксидантных процессов в тканях. Напротив, активность фермента каталазы в плазме крови у больных первой группы превышал контрольные значения здоровых женщин в 7,8 раза, у пациенток второй группы – в 7,2 раза соответственно (p0,01) (таблица 4).

Таблица 4 – Показатели уровней СОД и каталазы в эритроцитах и плазме крови больных УГХ Группы СОД (усл.ед/мг белка) Каталаза (ммоль/л) обследованных эритроциты плазма крови эритроциты плазма крови Первая 32,82±3,24* 1,39±0,14* 75,31±5,62* 0,186±0,12* Вторая 34,43±3,65 1,41±0,16* 69,52±6,83 0,173±0,10* Здоровые 41,37±4,19 1,89±0,23 57,32±2,31 0,024±0,005 Примечание: * – показатель достоверности между больными УГХ и здоровыми Глутатионредуктаза катализирует реакции разложения перекиси водорода с помощью восстановленного глутатиона, защищая липиды мембран от окисления и тем самым препятствует развитию патологических состояний. Показатели активности ГР эритроцитов при УГХ были достоверно понижены по сравнению со значениями здоровых лиц: максимально – у пациенток первой группы (7,24±1,59 мкмоль/сл; p0,05), минимально – второй группы (7,87±1,62 мкмоль/сл; p0,05), у здоровых женщин данный показатель составил 13,10±1,41 мкмоль/сл). Уровень ГР в плазме крови также имел тенденцию к снижению, наиболее выраженную у больных первой группы – 1,20±0,19 мкмоль/сл (p0,05) (в группе сравнения – 1,38±0,16 мкмоль/сл).

Повышение уровня ПОЛ и снижение АОС патогенетически связаны с развитием процессов деструкции рецепторного аппарата клеточных мембран (Rбелки), которые вызывают нарушения метаболизма здоровых клеток в окружающих тканях. Нарастание содержания R-белков в начале патологического процесса служит наиболее ранней манифестацией проявления воспаления.

Проведенные исследования выявили повышение уровня R-белков у больных УГХ, наиболее выраженное у пациенток первой группы (рисунок 3).

–  –  –

Выявлена супрессия функциональной активности Т-лимфоцитов у пациенток с УГХ по сравнению со здоровыми женщинами. Показатели РТМЛ были понижены у пациенток обеих групп. Однако, статистическую значимость различия данных показателей, по сравнению со здоровыми (47,59±7,95%), были выявлены только у первой группы (38,71±8,43%; p0,05). Проведенные исследования выявили общую для всех пациенток с УГХ тенденцию снижения функциональной способности лимфоцитов периферической крови к трансформации в бласты, усиливающуюся при контаминации половых путей энтерококками. Показатели спонтанной (171,8±21,5 имп/мин; р0,05) и индуцированной РБТЛ (4682,9±862,3 имп/мин; p0,05) у лиц первой группы имели большие изменения, чем у второй (215,7±29,2 имп/мин и 5613,4±679,1 имп/мин соответственно).

Аффинность Т-лимфоцитов также была понижена у всех фракций Еа-РОК при УГХ, но статистической значимости по сравнению со здоровыми она достигала только у высокоаффинных Еа-РОК и в первой, и во второй группах обследованных (0,273±0,038; 0,281±0,032 соответственно; р0,05).

Изучение гуморального иммунитета выявило статистически значимое повышение CD19+ лимфоцитов в обеих группах обследованных, особенно в первой, по сравнению с группой здоровых лиц (0,653±0,049109/л;

0,549±0,037109/л соответственно, р0,05). Уровень сывороточных иммуноглобулинов А, М, G был снижен, наиболее выраженная супрессия наблюдались у показателей Ig G (10,08±1,54 г/л) и Ig A (2,07±0,05 г/л) у обследованных первой группы (р0,05). Показатели Ig M не претерпевали значительных изменений, однако, наблюдалась тенденция к его повышению (p0,05).

Связывание антигена и антитела с образованием иммунного комплекса является одним из механизмов, направленных на элиминацию антигена из организма. Определение уровня ЦИК выявило его повышение у всех женщин с УГХ, наиболее выраженное при действии энтерококкового кофактора (217,6 у.е.; 198,4 у.е. соответственно, р0,05).

Большое диагностическое и прогностическое значение имеет изучение цитокинового профиля. У пациенток с УГХ отмечалось значимое повышение большинства провоспалительных цитокинов (IL-1, IL-2, IL-6, IL-8 и FNO-) с одновременным снижение содержания INF-, который продуцируется активированными Т-лимфоцитами и существенно усиливает активность - и интерферонов (таблица 6).

Таблица 6 – Содержание провоспалительных цитокинов у больных (пкг/мл) Группы Цитокины Группа Первая Вторая сравнения 194,5±10,2*/• 142,7±12,1* 37,2±4,8 IL-1 156,4±8,4* 142,9±9,5* 19,3±3,5 IL-2 12,5±2,3* 10,9±2,8* 4,8±1,2 IL-6 77,4±6,1*/• 54,9±7,2* 15,7±3,3 IL-8 148,4±10,2*/• 112,1±9,6* 36,3±5,9 FNOINF- Примечание: * – показатель достоверности между больными УГХ и здоровыми (p10,05);

• – показатель достоверности между больными УГХ с энтерококками и без (p20,05) Изменение уровня цитокинов, обладающих противовоспалительным действием, у больных УГХ имел разнонаправленный характер – показатели IL-4 снижались в первой группе обследованных в 3,3 раза, IL-10, наоборот, повышались в 3,6 раза по сравнению со здоровыми (рисунок 4).

–  –  –

45,1* 40 21,8 7,5 3,1* 2,3*

–  –  –

* – показатель достоверности между больными УГХ и здоровыми (p10,05);

• – показатель достоверности между больными УГХ с энтерококками и без (p20,05) Рисунок 4 – Изменение уровня противовоспалительных цитокинов у больных УГХ Далее у больных УГХ была проведена комплексная оценка функционального статуса нейтрофилов периферической крови. Изменения коснулись не только количественных, но и качественных показателей, отражающих поглотительную и киллинговую способность нейтрофилов. Выявлено сокращение количества нейтрофильных лейкоцитов с функциями фагоцитов. Так, фагоцитарный показатель у больных первой группы составил 47,2±4,4% (р1,20,05), второй – 53,9±3,8% (р20,05) (в группе сравнения – 69,4±4,1%). Фагоцитарное число, отражающее способность клеток к захвату возбудителей, было понижено в обеих группах, однако статистическую значимость изменения имели при сочетании УГХ с энтерококками (7,8 у.е.; р0,05).

Определение индекса завершенности фагоцитоза (ИЗФ) выявило значительное снижение переваривающей функции фагоцитов. Если у больных УГХ второй группы ИЗФ был равен 0,91±0,06 (у здоровых женщин 1,19±0,08;

р0,05), то у первой группы этот показатель был еще более низким (0,87±0,07; р0,05).

ЗАКЛЮЧЕНИЕ

Результаты проведенного исследования позволили сделать выводы, что у больных урогенитальным хламидиозом наблюдаются выраженные изменения редокс-системы, которые при отсутствии специфической клинической симптоматики, характерной для данного заболевания, имеют большое диагностическое значение. Проведенные собственные исследования по изучению видового состава микрофлоры влагалища у женщин с урогенитальным хламидиозом показало, что при этом заболевании происходит значительное нарушение микроэкологической системы репродуктивного тракта, проявляющееся достоверным изменением видового состава микроорганизмов влагалищного и цервикального биотопов. У больных урогенитальным хламидиозом в условиях изменения патогенного потенциала микробного консорциума урогенитального тракта отмечается расширение видового спектра микроорганизмов с превалированием высоковирулентных штаммов E. faecalis. Установлено, что у энтерококков, выделенных из микробного консорциума урогенитального тракта, в котором присутствовали C. trachomatis происходило статистически значимое увеличение показателей частоты встречаемости генетических детерминант патогенности.

Выявленные изменения системы ПОЛ-АОС поддерживают хроническое течение урогенитальных инфекций и участвуют в патогенезе их обострений.

Из этого следует, что биохимические показатели системы «оксидантыантиоксиданты» являются маркером оценки риска развития, тяжести течения и прогноза урогенитального хламидиоза. Изменение количественных и/или функциональных показателей звеньев иммунной системы приводит к нарушению процесса элиминации возбудителей и, как следствие, определяет хронический характер течения урогенитального хламидиоза и развитие его осложнений. Кроме того, депрессия иммунной системы способствует реализации патогенных свойств условно-патогенных возбудителей, в частности, энтерококков.

Установленные данные стимулируют дальнейшее изучение патогенного потенциала энтерококков и их влияние на течение инфекционного процесса.

Перспективой для дальнейшей разработки темы может явиться формирование модели повышения эффективности лечения, что позволит оптимизировать проводимую терапию.

ВЫВОДЫ

Установлено, что у 61,5% обследованных женщин с урогенитальным хламидиозом заболевание протекало в виде моноинфекции, у остальных обследованных урогенитальный хламидиоз сочетался с другими инфекциями, передаваемыми половым путем: урогенитальным герпесом (10,8% пациенток), урогенитальным микоплазмозом (7,8% больных) и папилломавирусной инфекцией (6,4% обследованных). У большинства обследованных выявлены клинические признаки воспалительного процесса – серозно- гнойные выделения (58,8%), гиперемия и отек слизистой оболочки наружного отверстия уретры (40,1%), отечность и гиперемия слизистой оболочки шейки матки 29,7%.

У 83,5% пациенток с урогенитальным хламидиозом выявлен дисбиоз репродуктивного тракта, проявляющийся в подавлении роста нормофлоры (Lactobacillus spp.) на фоне повышения показателей частоты встречаемости и плотности колонизации представителей условно-патогенной микрофлоры, с превалированием Enterococcus faecalis. У больных энтерококки обнаруживались во влагалище в 2,1 раза чаще, чем у здоровых женщин.

Сравнительное определение нуклеотидных последовательностей 3.

генов, детерминирующих экспрессию факторов патогенности Enterococcus faecalis у больных урогенитальным хламидиозом, выявило статистически значимое увеличение показателей их частоты встречаемости по сравнению со здоровыми: еsр (адгезия, колонизация) до 61,1±5,3%, asa (поверхностный белок-адгезин) до 39,5±6,4% и сylmА (активация цитолизина (бактериоциногенность) до 51,5±8,1%.

У пациенток с урогенитальным хламидиозом выявлен дисбаланс 4.

редокс-системы, проявляющийся активацией механизмов свободнорадикального окисления (каталазы, малонового диальдегида) и дефицитом ферментов антиоксидантной защиты (супероксиддисмутазы, глутатионредуктазы) в эритроцитах и в плазме крови, наиболее выраженный при обнаружении в репродуктивном тракте Enterococcus faecalis. Изменения редокс-системы у женщин с урогенитальным хламидиозом сопровождались активацией деструкции мембран, усиливающейся при выявлении энтерококков с высоким патогенным потенциалом, что подтверждалось положительной корреляционной взаимосвязью между уровнем малонового диальдегида и регуляторных белков при хламидиозе.



Pages:   || 2 |

Похожие работы:

«Нгуен Тхи Тху Ха МЕДОНОСНЫЕ РЕСУРСЫ ЛЕСНОГО ФОНДА ЛЕНИНГРАДСКОЙ ОБЛАСТИ И ЦЕНТРАЛЬНОГО ВЬЕТНАМА 06.03.02 Лесоведение, лесоводство, лесоустройство и лесная таксация АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург 2015 ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ Актуальность темы исследования. Использование недревесных ресурсов вносит существенный вклад в улучшение качества жизни населения многих стран, включая Россию и Вьетнам. До настоящего...»

«Рейф Ольга Юрьевна БИОЛОГИЧЕСКИЕ РЕСУРСЫ ОРЕХА МАНЬЧЖУРСКОГО (JUGLANS MANDSHURICA MAXIM.) В ПРИМОРСКОМ КРАЕ 03.02.14 – биологические ресурсы Автореферат диссертации на соискание ученой степени кандидата биологических наук Владивосток 2015 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования «Приморская государственная сельскохозяйственная академия». Научный руководитель: Гуков Геннадий Викторович, доктор...»

«НЕСТЕРОВ Александр Александрович УСОВЕРШЕНСТВОВАНИЕ ТЕХНОЛОГИИ ИЗГОТОВЛЕНИЯ ВАКЦИН ПРОТИВ ИНФЕКЦИОННОГО РИНОТРАХЕИТА КРУПНОГО РОГАТОГО СКОТА 06.02.02 «Ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология» Aвтореферат диссертации на соискание ученой степени кандидата ветеринарных наук Владимир – 2015 Работа выполнена в федеральном государственном бюджетном учреждении «Федеральный центр охраны здоровья животных» (ФГБУ «ВНИИЗЖ»)....»

«Авилова Екатерина Анатольевна Роль протеинкиназы PAK1 в регуляции роста эстрогензависимого и эстрогеннезависимого рака молочной железы Специальность 14.01.12 – онкология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2015 Работа выполнена в Федеральном государственном бюджетном научном учреждении «Российский онкологический научный центр имени Н.Н.Блохина» (директор – д.м.н., проф., академик РАН М.И. Давыдов). Научный руководитель:...»

«РАДУГИНА Елена Александровна РЕГУЛЯЦИЯ МОРФОГЕНЕЗА РЕГЕНЕРИРУЮЩЕГО ХВОСТА ТРИТОНА В НОРМЕ И В УСЛОВИЯХ ИЗМЕНЕННОЙ ГРАВИТАЦИОННОЙ НАГРУЗКИ 03.03.05 – Биология развития, эмбриология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва 2015 ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ Актуальность темы исследования. Исследования в области регенерации, начавшиеся еще в XVIII веке, вновь приобрели актуальность с появлением современных методов исследования....»

«Степина Елена Владимировна ЭКОЛОГО-ФЛОРИСТИЧЕСКАЯ ХАРАКТЕРИСТИКА СТЕПНОЙ РАСТИТЕЛЬНОСТИ ЮГО-ЗАПАДНЫХ РАЙОНОВ САРАТОВСКОЙ ОБЛАСТИ 03.02.08 – экология (биологические науки) Автореферат диссертации на соискание ученой степени кандидата биологических наук Саратов – 2015 Работа выполнена в Балашовском институте (филиале) федерального государственного бюджетного образовательного учреждения высшего профессионального образования «Саратовский государственный университет имени Н.Г....»

«КУРТАНОВ Харитон Алексеевич ОКУЛОФАРИНГЕАЛЬНАЯ МИОДИСТРОФИЯ И ВАРИАБЕЛЬНОСТЬ ЛОКУСА ОФМД В ПОПУЛЯЦИЯХ ЯКУТИИ 03.02.07 – генетика АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Томск – 2015 Работа выполнена в Федеральном государственном бюджетном научном учреждении «Научно-исследовательский институт медицинской генетики» и в Федеральном государственном бюджетном научном учреждении «Якутский научный центр комплексных медицинских проблем» Научный...»

«Калинкин Дмитрий Евгеньевич ФАКТОРЫ ФОРМИРОВАНИЯ ЗДОРОВЬЯ НАСЕЛЕНИЯ ГОРОДОВ В ЗОНЕ ВОЗДЕЙСТВИЯ ПРЕДПРИЯТИЙ АТОМНОЙ ИНДУСТРИИ 14.02.03 – общественное здоровье и здравоохранение Автореферат диссертации на соискание учёной степени доктора медицинских наук Томск – 2015 Работа выполнена в Федеральном государственном унитарном предприятии «Северский биофизический научный центр» Федерального медикобиологического агентства Российской Федерации (г. Северск) Научный консультант: доктор...»

«Попов Игорь Олегович НАБЛЮДАЕМЫЕ И ОЖИДАЕМЫЕ КЛИМАТООБУСЛОВЛЕННЫЕ ИЗМЕНЕНИЯ РАСПРОСТРАНЕНИЯ ИКСОДОВЫХ КЛЕЩЕЙ IXODES RICINUS И IXODES PERSULCATUS НА ТЕРРИТОРИИ РОССИЙСКОЙ ФЕДЕРАЦИИ И СТРАН БЛИЖНЕГО ЗАРУБЕЖЬЯ Специальность 03.02.08 «Экология» АВТОРЕФЕРАТ диссертации на соискание ученой...»

«АФГОНОВ МУХАММАДАЛИ МИРАЛИЕВИЧ Системно-деятельностный подход к гуманитарно-краеведческой воспитательной деятельности в общеобразовательных учреждениях Республики Таджикистан 13.00.01 общая педагогика, история педагогики и образования (педагогические науки) АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора педагогических наук Душанбе 2015 Работа выполнена на общеуниверситетской кафедре педагогики Таджикского национального университета доктор педагогических наук,...»

«Абдурахманов Шамиль Гайирбегович ЖУКИ-ДРОВОСЕКИ (COLEOPTERA, СЕКАМВУСШАЕ) РЕСПУБЛИКИ ДАГЕСТАН (фауна, зоогеография и трофические связи) Специальность 03.02.04 зоология Автореферат диссертации на соискание ученой степени кандидата биологических наук 1П Махачкала 2013 Работа выполнена на кафедре биологаи и биоразнообразия ФГБОУ ВПО «Дагестанский государственный университет» Научный руководитель: кандидат биологических наук, ведущий научный сотрудник Зоологического инсипута РАН...»

«БАММАТОВ ДЖАНБОЛАТ МУСАЕВИЧ СОЧЕТАННЫЕ ПРИРОДНЫЕ ОЧАГИ ИНФЕКЦИОННЫХ БОЛЕЗНЕЙ В РАВНИННО-ПРЕДГОРНОЙ ЧАСТИ РЕСПУБЛИКИ ДАГЕСТАН 14.02.02 – эпидемиология 03.02.03 микробиология Автореферат диссертации на соискание учёной степени кандидата медицинских наук Ставрополь – 2013 Работа выполнена в Федеральном казнном учреждении здравоохранения «Дагестанская противочумная станция» и Федеральном казнном учреждении здравоохранения «Ставропольский научно-исследовательский противочумный...»

«ГОРЕЛИК Светлана Гиршевна МЕДИКО-СОЦИАЛЬНАЯ РЕАБИЛИТАЦИЯ ПАЦИЕНТОВ ХИРУРГИЧЕСКОГО ПРОФИЛЯ В СТАРЧЕСКОМ ВОЗРАСТЕ 14.01.30 – геронтология и гериатрия Автореферат диссертации на соискание ученой степени доктора медицинских наук Самара 2015 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении дополнительного профессионального образования «Институт повышения квалификации Федерального медико-биологического агентства» доктор медицинских наук, доцент...»

«Мечов Максим Павлович КЛИНИКО-МОРФОЛОГИЧЕСКИЕ ОСОБЕННОСТИ РЕПАРАТИВНОГО ОСТЕОГЕНЕЗА ПРИ ИМПЛАНТАЦИИ ФИКСАТОРОВ С ПОКРЫТИЕМ НА ОСНОВЕ МЕТАЛЛОВ IV ГРУППЫ 06.02.04 – ветеринарная хирургия Автореферат диссертации на соискание ученой степени кандидата ветеринарных наук Москва – 2015 Работа выполнена на кафедре ветеринарной хирургии ФГБОУ ВПО «Казанская государственная академия ветеринарной медицины им. Н.Э. Баумана» Научный руководитель Шакирова Фаина Владимировна доктор...»

«Шуман Леонид Александрович ГИСТОПАТОЛОГИЧЕСКИЕ ИЗМЕНЕНИЯ И РЕПРОДУКЦИОННЫЙ ПОТЕНЦИАЛ У РЫБ В ВОДОЕМАХ ОБЬ-ИРТЫШСКОГО БАССЕЙНА С РАЗЛИЧНОЙ АНТРОПОГЕННОЙ НАГРУЗКОЙ 03.02.06 – ихтиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва, 2015 Работа выполнена в Центре экологических исследований и реконструкции биосистем Института Биологии Тюменского государственного университета Научный руководитель: доктор биологических наук, доцент Селюков...»

«ЕРМОШ ЛАРИСА ГЕОРГИЕВНА НАУЧНО-ПРАКТИЧЕСКОЕ ОБОСНОВАНИЕ ПОЛУЧЕНИЯ ПРОДУКТОВ ПОВЫШЕННОЙ ПИЩЕВОЙ ЦЕННОСТИ С ИСПОЛЬЗОВАНИЕМ КЛУБНЕЙ ТОПИНАМБУРА 05.18.01 – Технология обработки, хранения и переработки злаковых, бобовых культур, крупяных продуктов, плодоовощной продукции и виноградарства АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора технических наук Красноярск – 2015 Работа выполнена в ФГАОУ ВПО «Сибирский федеральный университет» доктор биологических наук, профессор...»

«ШАХТАМИРОВ Иса Янарсаевич КАРИОПАТОЛОГИЯ У ЖИВОТНЫХ В ЗОНАХ СТОЙКИХ ОРГАНИЧЕСКИХ ЗАГРЯЗНИТЕЛЕЙ ВНЕШНЕЙ СРЕДЫ 03.02.07 – генетика АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Санкт-Петербург Работа выполнена в Федеральном государственном бюджетном учреждении высшего профессионального образования «Чеченский государственный университет» Научный консультант: доктор биологических наук, профессор Кравцов Вячеслав Юрьевич Официальные оппоненты:...»

«ЖАДАМБАА ДАВААБААТАР ВЛИЯНИЕ ТЕХНОГЕННОГО ЗАГРЯЗНЕНИЯ НА ОКРУЖАЮЩУЮ СРЕДУ ДАРХАНСКОГО АЙМАКА МОНГОЛИИ 03.02.08 – экология (биология) Автореферат диссертации на соискание ученой степени кандидата биологических наук Красноярск – 2015 Работа выполнена в ФГБОУ ВПО «Красноярский государственный аграрный университет» Научный руководитель: Цугленок Николай Васильевич доктор технических наук, профессор Официальные оппоненты: Первышина Галина Григорьевна доктор биологических наук,...»

«ЛЮТОВА ЕКАТЕРИНА ВЛАДИМИРОВНА СОВЕРШЕНСТВОВАНИЕ ТЕХНОЛОГИИ ПЛАВЛЕНОГО СЫРА, ОБОГАЩЕННОГО ИКРОЙ И МОЛОКАМИ СЕЛЬДИ БАЛТИЙСКОЙ (CLUPEA HARENGUS MEMBRAS) 05.18.04 Технология мясных, молочных, рыбных продуктов и холодильных производств 05.18.07 Биотехнология пищевых продуктов и биологических активных веществ Автореферат диссертации на соискание ученой степени кандидата технических наук Калининград 2015 Работа выполнена в Федеральном государственном бюджетном образовательном...»

«Авилова Анастасия Александровна Экологическая оценка годичной динамики тяжелых металлов в базовых компонентах лесных экосистем северной части Московского мегаполиса (на примере ЛОД РГАУ МСХА имени К. А. Тимирязева) Специальность 03.02.08 – экология (биология) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2015 Работа выполнена на кафедре экологии ФГБОУ ВО «Российский государственный аграрный...»







 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.