WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 

Pages:   || 2 |

«Оценка микробиоты ротовой полости у детей с онкогематологическими заболеваниями ...»

-- [ Страница 1 ] --

На правах рукописи

Вечерковская Мария Фёдоровна

Оценка микробиоты ротовой полости у детей с онкогематологическими

заболеваниями

03.02.03. – микробиология

АВТОРЕФЕРАТ

диссертации на соискание учёной степени

кандидата медицинских наук

Санкт-Петербург – 2015

Работа выполнена в Государственном бюджетном образовательном учреждении

высшего профессионального образования «Первый Санкт - Петербургский

Государственный медицинский университет имени академика И.П. Павлова»

Министерства здравоохранения Российской Федерации

Научный руководитель: доктор медицинских наук, профессор Тец Виктор Вениаминович

Официальные оппоненты:

Афиногенов Геннадий Евгеньевич, доктор медицинских наук, профессор, Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "Санкт-Петербургский государственный университет", кафедра челюстно-лицевой хирургии и хирургической стоматологии факультета стоматологии и медицинских технологий, профессор кафедры.

Анатолий Сергеевич Быков, доктор медицинских наук, профессор, Государственное бюджетное образовательное учреждение высшего профессионального образования "Первый Московский государственный медицинский университет имени И.М. Сеченова" Министерства здравоохранения Российской Федерации, кафедра микробиологии, вирусологии и иммунологии, профессор кафедры.

Ведущая организация:

Федеральное бюджетное учреждение науки “Санкт-Петербургский научноисследовательский институт эпидемиологии и микробиологии имени Пастера”.

(ФБУН НИИЭМ имени Пастера).

Защита состоится «___» ________ 2015 года в ____ часов на заседании диссертационного совета Д 208.046.01 при Федеральном бюджетном учреждении науки «Московский научно-исследовательский институт эпидемиологии и микробиологии им. Г.Н. Габричевского» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по адресу: 125212, Москва, ул.

Адмирала Макарова, д.10.

С диссертацией можно ознакомиться в библиотеке и на сайте Федерального бюджетного учреждения науки «Московский научно-исследовательский институт эпидемиологии и микробиологии им. Г.Н.

Габричевского» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека по адресу:

125212, Москва, ул. Адмирала Макарова, 10, http://www.gabrich.ru

Автореферат разослан «______» __________ 2015 г.

Учёный секретарь диссертационного совета, доктор медицинских наук Борисова Ольга Юрьевна

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы исследования Современные данные указывают на огромную роль микрофлоры в качестве важнейшего «органа» гомеостаза, влияющего на развитие хозяина, его физиологию и морфогенез (Sommer F., Bckhed F., 2013). С нарушениями состава и функционирования микрофлоры связывают формирование различных соматических заболеваний. Установлено, что колонизация слизистой ротовой полости рядом условно-патогенных и патогенных бактерий в значительной степени повышает вероятность возникновения не только местных патологических изменений, но и служит причиной формирования ряда различных соматических заболеваний. В значительной степени это связано с существованием микробных биоплёнок и наличием в их составе неизвестных науке бактерий, обозначаемых как «некультивируемые» и «пока не культивируемые». Трудности в работе с такими микробами обусловлены, прежде всего, отсутствием современных программ, позволяющих суммировать и анализировать большие объёмы различной информации, полученной в результате исследования микроорганизмов классическими микробиологическими, биохимическими и современными молекулярногенетическими методами. Кроме того, необходима разработка новых экспериментальных подходов, позволяющих выделить смешанные микробные сообщества, изолировать и идентифицировать входящие в их состав различные ранее не культивируемые бактерии. Условия, необходимые для роста таких микроорганизмов, пока считаются невоспроизводимыми в лабораторных условиях (Epstein S.S., 2009).

Несмотря на очевидную актуальность, проблема распространения условнопатогенных и патогенных бактерий при различной патологии, в том числе, у детей с онкогематологическими заболеваниями в условиях применяемой терапии остаётся практически не изученной.

Поэтому оценка микробиоты здоровых детей и детей с онкогематологическими заболеваниями, выявление видового состава представителей микрофлоры, описание свойств полимикробных сообществ, которые они образуют, и определение биологических свойств бактерий, является актуальным и имеет не только теоретическое, но и практическое значение.

Степень разработанности темы исследования В последние годы по результатам мировых и отечественных исследований расширилось представление о микрофлоре человека и многообразии её функций. С каждым годом появляются новые данные о том, какие именно микроорганизмы отвечают за определённый процесс взаимодействия микробиоты и хозяина в естественных условиях, а также о роли микробных ассоциаций в патогенезе инфекционных и не инфекционных заболеваний (Harding M.W. et al., 2009; Thoulouze M.I., Alcover A., 2011; Harriott M.M., Noverr M.C., 2011). Одновременно все больше различных заболеваний связывают с нарушениями состава и функционирования микрофлоры (Тец В.В., 2007; 2008). Среди них, такие патологические состояния как сахарный диабет тип 2 (Shillitoe E. et al., 2012; Li X. et al., 2000); ожирение (Turnbaugh P.J. et al., 2006; Tilg H. et al., 2009); атопический дерматит (De Benedetto A. et al., 2009;

Niebuhr M., 2010); экзема (Abrahamsson T.R. et al., 2012; Adlerberth I. et al., 2007);

псориаз (Fahlen A. et al., 2012); аллергические реакции (Bisgaard H. et al., 2011; Larsen J.M. et al., 2009); бронхиальная астма (Penders J. et al., 2011; Huffnagle G.B., 2010);

СРК (Vanderploeg R. et al., 2010; Chassaing B, Darfeuille Michaud A., 2011);

нефролитиаз (Kaufman D.W. et al, 2008); атеросклероз (Caesar R et al., 2010; Wang Z. et al., 2011); тромбозы (Ohki T. et al., 2012); инфаркт миокарда (Ishihara K. et al., 2004).

С пониманием важности микрофлоры в развитии организма и формировании предрасположенности к широко распространённым патологическим состояниям, возник большой интерес к изучению микрофлоры, в том числе, у детей. Тем не менее, большая часть исследований носит «точечный» характер, охватывая такие хорошо известные проблемы как детский и подростковый кариес (Kanasi E. et al., 2010) (Tanner A.C.R. et al., 2011; Gross E. L., 2010), аллергические реакции (Sjgren Y.M. et al., 2009; Johansson M.A. et al., 2011), атопический дерматит (Candela M. et al., 2012;

van Nimwegen F.A. et al, 2011), детское и подростковое ожирение (Payne A.N. et al, 2011; Vael C. et al., 2011; Elli M. et al., 2010). В то же время, микрофлора при других заболеваниях остаётся практически не изученной и лишь единичные работы посвящены исследованию нормальной микробиоты ротовой полости здоровых детей (Papaioannou W. et al., 2009; Tanner A.C.R. et al., 2002; Babaahmady K.G. et al., 1997;

Milnes A.R. et al., 1993; Kang J.G. et al., 2006; Kamma J.J. et al., 2000).

На сегодняшний день, накоплено много данных о роли микробных ассоциаций как в естественных условиях, так и в патогенезе инфекционных и не инфекционных заболеваний (Harding M.W. et al., 2009; Thoulouze M.I., Alcover A., 2011; Harriott M.M., Noverr M.C., 2011). Вместе с тем, практически не изученными остаются особенности состава микробных сообществ у детей, в частности, недостаточно данных о составе нормальной микрофлоры здоровых детей.

Одним из актуальных направлений современной микробиологии является изучение не культивируемых или пока не культивированных бактерии, которые не способны расти в виде чистых культур в лабораторных условиях. В последние годы появляется все больше примеров выявления некультивированных бактерий при различных заболеваниях (Ling Z. et al., 2010; Marques da Silva R. et al., 2006; Kim E. et al., 2008; Fenollar F. et al., 2006; Welinder Olsson C. et al., 2010). К настоящему моменту накопилось значительное количество данных о разнообразных подходах к выделению и идентификации бактерий, не поддающихся культивированию в обычных условиях (Vartoukian S.R. et al., 2010; Sizova M.V. et al., 2012; Janssen P.H.

Zengler K. 2008; Puspita I.D. et al., 2012; Bruns A. et al., 2002; Ingham C.J. et al., 2007;

Kell D.B. Young M. 2000; Nichols D. et al., 2008; Shah I.M. et al., 2008; Bollmann A. et al., 2007; Aoi Y. et al., 2009; Ferrari B.C. et al., 2008; Amanullah A. et al., 2010).

Исследование микробиоты детского возраста, описание входящих в её состав микроорганизмов позволит раскрыть механизмы влияния представителей микрофлоры на организм детей и дополнить наше понимание о роли бактерий в формировании патологических состояний детского возраста.

Цель исследования Оценка состава и свойств смешанных микробных сообществ микробиоты слюны здоровых и больных онкогематологическими заболеваниями детей, разработка алгоритма получения чистых культур пока некультивируемых бактерий и создание специальной базы данных результатов проводимых исследований.

Задачи исследования:

1. С помощью микробиологических, биохимических и молекулярно-биологических методов исследовать состав и свойства представителей микробиоты слюны (с учётом некультивируемых бактерий) здоровых детей и детей с онкогематологическими заболеваниями в стадии ремиссии в возрасте от 2 до 10 лет.

2. Выявить, выделить и идентифицировать бактерии, встречающиеся только в микрофлоре детей с онкогематологическими заболеваниями.

3. Молекулярно-генетическая характеристика (с оценкой генома, генов патогенности и антибиотикоустойчивости) впервые выявленных ранее не известных бактерий с установлением их положения в систематике.

4. Разработать оригинальную электронную базу данных результатов проводимых исследований, позволяющую оперативно суммировать, сохранять и анализировать информацию о биологических особенностях микроорганизмов и их сообществах с последующей их идентификацией.

Научная новизна исследования Установлено, что микробиота детей с онкогематологическими заболеваниями не идентична микробиоте здоровых детей и характеризуется обеднённым разнообразием культивируемых микроорганизмов - отсутствием представителей 3-х Гротрицательных и 2-х Гр-положительных родов, выявлением дрожжеподобных грибов и повышенной резистентностью к различным антибиотикам.

Показано, что смешанные бактериальные сообщества, полученные из материала ротовой полости детей, обладают определённой стабильностью, воспроизводятся при пересевах и содержат культивируемые и пока не культивируемые бактерии, многие из которых не удаётся получить в виде чистых культур на использованных известных питательных средах.

В составе микрофлоры слюны детей с онкогематологическими заболеваниями в составе смешанных микробных сообществ выделены бактерии, не встречавшиеся в группе здоровых детей, которые по результатам сравнительного анализа последовательностей гена 16S рРНК, полного генома, гибридизации ДНК, данных протеомного и биохимического анализов, морфологических свойств, были идентифицированы как новый, ранее неизвестный вид рода Streptococcus.

Впервые изучен геном нового, выявленного вида стрептококков, который содержит различные гены патогенности и антибиотикоустойчивости (бета-лактамаза класса А, устойчивость к гликопептидам) (геном аннотирован в NCBI № CP007628 (http://www.ncbi.nlm.nih.gov/nuccore/CP007628.1) и сиквенс гена, кодирующего 16S рРНК, № KF780584 (http://www.ncbi.nlm.nih.gov/nuccore/KF780584).

Разработана оригинальная электронная база данных результатов проводимых исследований «Microbes», адаптированная для потребностей микробиологических исследований, которая позволяет накапливать и систематизировать данные, получаемые в ходе экспериментов, проводить их анализ с помощью нового биоинформативного алгоритма (свидетельство о государственной регистрации базы данных «Microbes» №2013620895 от 08 августа 2013г.).

Теоретическая и практическая значимость работы Изучение состава и свойств микроорганизмов из смешанных микробных сообществ из слюны позволило получить новые данные о микрофлоре здоровых детей и детей с онкогематологическими заболеваниями, содержащей культивируемые и пока не культивируемые бактерии, что расширяет знания о микробиоте детского возраста и дополняет понимание об изменениях микрофлоры в процессе лечения с применением протоколов, включающих использование цитостатиков и противомикробных препаратов. Идентифицирован микроорганизм, ранее не описанный и прежде не поддававшийся культивированию, изучен его геном, гены патогенности и антибиотикоустойчивости.

Полученные результаты исследования послужили основой для использования характеристики микробиоты как патогенетического маркёра развития патологических процессов инфекционного и не инфекционного генеза.

Определены подходы к выделению и получению в виде чистых культур бактерий, не поддающихся культивированию в стандартных условиях, дополняющие характеристику микробиоты ротовой полости.

Разработанная электронная база данных результатов проводимых исследований "Microbes" позволяет оперативно суммировать, сохранять и анализировать информацию, связанную с культивированием смешанных микробных популяций с разделением отдельных их компонентов и идентификацией на основе бактериологических, бактериоскопических, биохимических и молекулярногенетических методов.

Полученные результаты внедрены и используются в работе лаборатории иммунологии научно-исследовательского центра ГБОУ ВПО "ПСПбГМУ им.

академика И.П. Павлова" МЗ РФ и кафедры микробиологии, вирусологии и иммунологии им. академика Д.К. Заболотного ГБОУ ВПО "ПСПбГМУ им. академика И.П. Павлова" МЗ РФ при проведении научных исследований и в учебном процессе в лекционном курсе и практических занятиях студентов лечебного, педиатрического и стоматологического факультетов, а также при обучении аспирантов по специальности "Микробиология" (акт о внедрении от 18 декабря 2014 года).

Методология и методы исследования Методологической основой исследования послужили работы отечественных и зарубежных учёных в области классической микробиологии, молекулярной биологии, генетики и биоинформатики. Предметом работы стало изучение сообществ, полученных из слюны здоровых и больных онкогематологическими заболеваниями детей в возрасте от 2 до 10 лет, выделение и идентификация бактерий, не поддающихся культивированию в стандартных условиях, создание специальной базы микробиологических данных.

Научная литература, посвящённая изучению микробиоты человека, была проанализирована формально-логическими методами. В работе использованы микробиологические, масс-спектрометрические, иммунохимические, молекулярногенетические, биоинформационные, электронно-микроскопические и статистические методы исследования.

Материалы и методы исследования Слюну для исследования собирали у детей двух групп в возрасте от 2-х до 10-ти лет. В первую группу входили пациенты с онкогематологическими заболеваниями в стадии ремиссии, не проходившие антибиотикотерапию в течение последних трёх месяцев, со схожими протоколами лечения основного заболевания, находившихся на лечении в дневном стационаре ИДГиТ им. Р.М. Горбачёвой, и второй группы, которая включала учеников начальных классов школ и детских садов города СанктПетербурга. Перед взятием материала родителями/законными представителями оформлялось информированное согласие на участие в исследовании.

В работе использованы стандартные штаммы бактерий из международной коллекции: Staphylococcus aureus АТСС 29213, Escherichia coli АТСС 25922 Микробиологические методы Для культивирования в работе использованы питательные среды: мясопептонный бульон и агар, тиогликолевая транспортная среда, среда М9 (НИЦФ, РФ), Колумбийский агар с добавлением эритроцитов барана и лошадиной сыворотки, бруцелла агар и трипказосоевый агар (bioMerieux, Франция и Oxoid, Великобритания). Культивирование микроорганизмов проводили в аэробных и анаэробных условиях в течение 18-120 часов при температурах 35°С и 37°С в обычной атмосфере и с использованием СО2 инкубатора MCO-19AC (Sanyo, Япония) и газогенераторных пакетов GENbag (bioMerieux, Франция).

Изучение морфологии колоний и клеток выполнено с помощью биологического стереомикроскопа МСП-1 с увеличением 10-80х, зум-объектив 1-4х, окуляр 10х (ЛОМО, Россия), бинокулярного микроскопа Axiostar plus (Carl Zeiss, Германия), оснащённого иммерсионным объективом A-Plan 100x/1.25, окуляр 10х (Carl Zeiss, Германия). Макро и микрофотографии получали с помощью цифрового фотоаппарата Canon EOS 60 D (Canon, Япония), оснащённого адаптером для микроскопа МСП ЦФК (ЛОМО, Россия) или Photo adjustment 1.6х for Zeiss microscopes (Askania Mikroskop Technik Rathenow GmbH, Германия). Электронная микроскопия выполнена на микроскопах JEM-100S (Jeol, Япония) при инструментальном увеличении 1000-5000х и Libra120 (Carl Zeiss, Германия) при инструментальном увеличении 2000 - 100 000х.

Идентификацию микроорганизмов осуществляли на основе рутинных бактериологических методов с учётом тинкториальных, морфологических, культуральных и биохимических свойств с использованием Справочника Берджи по систематике бактерий (Bergey's Manual of Systematic Bacteriology v 1-5). Определение биохимической активности микроорганизмов проводили с помощью диагностических тест-систем STAPHYtest-24 (ErbaLaChema, Чехия) и API-Staph (BioMerieux, Франция), тест-систем АНАЭРОтест (Lachema, Чехия), системы Vitek 2 (bioMerieux, Франция). Протеомный анализ осуществляли с использованием масс-спектрометрии MALDI-TOF/TOF.

Определение чувствительности полученных культур к антибиотикам проводили с помощью диско-диффузионного метода, определение минимальной ингибирующей концентрации с использованием тест полосок "E-test", содержащих антимикробные препараты: азитромицин, амоксициллин-клавуланат, ампициллин, левофлоксацин, клиндамицин, метронидазол, оксациллин, цефаклор, эритромицин, ципрофлоксацин, цефотаксим, кларитромицин, рокситромицин, амикацин, меропенем, левомицетин, триметоприм-сульфаметоксазол (НИЦФ, РФ), амфотерицин В, итраконазол, флюконазол и каспофунгин (bioMerieux, Франция). Оценку чувствительности микроорганизмов осуществляли согласно МУК 4.2.1890-04 и стандартам, рекомендуемым Институтом клинических и лабораторных стандартов (Clinical and Laboratory Standarts Institute, CLSI, США) Молекулярно-биологические методы Отбор единичных бактериальных клеток из смешанных сообществ методом лазерной микродиссекции проводили с использованием системы PALM MicroBeam (Carl Zeiss, Германия) под контролем видеокамеры, с помощью роботизированной системы контроля лазера PALM RoboSoftware v 4.6.

Для выделения геномной ДНК бактерий использовали фенол-хлороформный метод (Miller J.H., 1972). Амплификацию гена 16S рРНК проводили с использованием “универсальных” праймеров: прямой - 27F 5’AGAGTTTGGATCАTGGCTCAG3’, обратный - 1492R 5’CGGTTACCTTGTTACGACTT3' (Lane D.J., 1991), (Евроген, Россия). Для постановки полимеразной цепной реакции (ПЦР), в 20 мкл реакционной смеси добавляли 0,1 мкл выделенной ДНК. Реакционная смесь помимо ДНК содержала 67 мМ Трис-HCl (pH 8,6), 2,5 мМ MgCl2, 16,6 мМ (NH4)2SO4, 0,5 мМ каждого дНТФ, по 5 пмоль каждого из праймеров и 2,5 Е Taq ДНК полимеразы (Силекс, Россия). Матрицу денатурировали 3 мин при 94°C, ДНК амплифицировали в течении 30 циклов каждый из которых включал денатурацию (94°C, 30 сек), отжиг (58°C, 30 сек) и синтез (72°C, 1 мин). В качестве контроля использовали реакционную смесь без добавления ДНК.

Секвенирование гена 16S рибосомальной РНК проводили с помощью набора BigDyeTMTerminatorv.3.1 CycleSequencing (Applied Biosystem, США), автоматического секвенатора ABIPrismGeneticAnalyzer 3730XL (Applied Biosystems, США) и программного пакета Sequencing Analysis 5.3.1 (Applied Biosystems, США).

Сиквенс генома бактерий проведён набором TruSeq Rapid Cluster Kit - Paired-End and Single-Read (Illumina, США) согласно инструкции производителя на секвенаторе Illumina HiSeq 2500 (Illumina, США) при конверсии исходных данных в fastq формат с помощью программы BaseSpace (Illumina, США).

Статистическая обработка, анализ данных и программное обеспечение Идентификация бактерий по нуклеотидной последовательности гена 16S рРНК проводилась с использованием баз данных: HOMD 16S rRNA RefSeq v13.2, SILVA release 115 SSU Ref., NCBI 16S rRNA/WGS/Reference genomic sequences/nucleotide collection при помощи алгоритма megablast (bast v 2.2.28). Результаты поиска оценивали при помощи программы CLUSTALW.

Выравнивание гена 16S рРНК и проверка сиквенса на формирование химер выполнены с использованием программ Geneious R8 (Biomatters Ltd., США), DECIPHER и UCHIME.

Построение дендрограмм для филогенетического анализа выполнено на основе баз данных: HOMD 16S rRNA RefSeq v13.2, SILVA release 115 SSU Ref., NCBI refseq_rna/WGS/Reference genomic sequences/nucleotide collection, алгоритма megablast и программы CLUSTALW а также метода neighbour-joining. Дендрограммы строили в программе ARB или Geneious R8 (Biomatters Ltd., США), с использованием приложения PhyML.

Сборка геномов бактерий выполнена с использованием программы Velvet v 1.2.10 Mauve с ресеквенированием участков, содержащих пробелы.

Аннотация генома в предварительном варианте сделана с помощью сервера RAST полная - вручную с использованием программ GeneMarks Infernal и баз Rfam, Pfam UniProt.

Виртуальная ДНК-ДНК гибридизация проведена с помощью алгоритма GGDC BLAT v 2.0 Leibniz-Institut DSMZ – Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH и референсных штаммов из базы GenBank.

Усреднённая идентичность нуклеотидов определена с помощью программы JSpecies и референсных штаммов из базы GenBank.

Депонирование сиквенсов в GenBank проводили при помощи инструментов, доступных на сайте NCBI (программы Sequin и tbl2asn), согласно требованиям GenBank.

Создание базы данных результатов проводимых исследований выполнено с использованием программы FileMaker Pro Advanced v 12 (FileMaker Inc., США), иерархической системы – модифицированная SeedCode Hierarchy Pro с использованием высокоуровневых нативных языков написания скриптов: AppleScript для OSX и VBScript для Windows.

Создание удалённого доступа к базе данных выполнено с помощью программы FileMaker Server v 12.

Статистическую обработку данных проводили с использованием интерактивного языка высокого уровня Octave (критерии Стьюдента и Краскела — Уоллиса). Octave – среда, содержащая набор инструментов для проведения сложных вычислений и построения графиков.

Личное участие автора в получении результатов Соискателем составлен план работы, проведён аналитический обзор литературы.

Автором самостоятельно выполнены все основные разделы работы, проведено изучение нормальной микрофлоры, выделение бактерий и смешанных микробных сообществ, их бактериологическое, микроскопическое, биохимическое и молекулярно-генетическое исследование. Автором самостоятельно с использованием лицензионных компьютерных программ выполнены все биоинформативные исследования, включая сборку секвенированных генов и геномов, их аннотация, анализ состава генов, сравнение геномов, построение дендрограмм, гибридизация геномов, разработка и написание новой оригинальной базы данных, необходимой для анализа большого числа разнородной информации.

Консультации и помощь в выборе пациентов осуществлено совместно с директором "НИИ детской онкологии, гематологии и трансплантологии им. Р.М.

Горбачевой", заслуженным врачом РФ, д.м.н., профессором Афанасьевым Б.В.;

секвенирование 16S рРНК и генома бактерий проводились совместно со старшим научным сотрудником лаборатории иммунологии научно-исследовательского центра ГБОУ ВПО "ПСПбГМУ им. акад. И.П. Павлова" МЗ РФ, к.м.н. Тецем Г.В.;

микробиологические исследования проводились совместно со старшим научным сотрудником лаборатории иммунологии научно-исследовательского центра ГБОУ ВПО "ПСПбГМУ им. акад. И.П. Павлова" МЗ РФ, к.б.н. Доморад А.А.

Положения, выносимые на защиту:

1. Смешанные микробные сообщества микробиоты здоровых детей и детей с онкогематологическими заболеваниями в возрасте от 2 до 10 лет обладают определённой стабильностью. Микробиота детей с онкогематологическими заболеваниями отличается обеднённым разнообразием бактерий, наличием дрожжеподобных грибов, а также распространённостью генов антибиотикоустойчивости.

2. В составе микрофлоры ротовой полости детей, проходивших терапию в связи с онкогематологическими заболеваниями, в составе смешанных микробных сообществ имеются бактерии, не встречавшиеся в группе здоровых детей, которые идентифицированы как новый, ранее неизвестный вид рода Streptococcus. Геном нового, выявленного вида стрептококков содержит гены патогенности и антибиотикоустойчивости.

3. Новая, оригинальная электронная база данных результатов проводимых исследований позволяет оперативно суммировать, сохранять и анализировать информацию, связанную с культивированием смешанных микробных сообществ, с разделением отдельных их компонентов и последующей идентификацией на основе бактериологических, биохимических и молекулярно-генетических методов.

Степень достоверности и апробация результатов исследования О достоверности полученных результатов работы свидетельствует использование сертифицированных материалов и методов бактериологического, биохимического и молекулярно-биологического исследования. Полученные данные сопоставимы с данными литературы, что свидетельствует о достоверности полученных результатов.

Сиквенс полного генома прошёл оценку специалистами NCBI.

Диссертация апробирована на совместном заседании проблемной комиссии «Микробиология и иммунология» и кафедры микробиологии, вирусологии и иммунологии ГБОУ ВПО ПСПбГМУ им. акад. И.П. Павлова МЗ РФ, протокол № 14от 22 декабря 2014 года.

Результаты исследований были представлены и обсуждены на «Всероссийской научно-практической конференции по медицинской микробиологии и клинической микологии (XV Кашкинские чтения)» (Санкт-Петербург, 2012г.); Научнопрактической конференции с международным участием «Общие вопросы диагностики и лечения заболеваний ЛОР-органов и челюстно-лицевой области (IV Плужниковские чтения)» (Санкт-Петербург, 2012г.); VIII международном конгрессе «Рациональная фармакотерапия - 2013» (Санкт-Петербург, 2013г.).

Публикации. По материалам диссертации опубликовано 6 работ, в том числе 4 – в рецензируемых изданиях, 2 – в других изданиях; получено авторское свидетельство о государственной регистрации БД № 2013620895 от 08 августа 2013 года. В NCBI зарегистрированы полный геном № CP007628 (http://www.ncbi.nlm.nih.gov/nuccore/CP007628.1) и сиквенс гена, кодирующего 16S рРНК, № KF780584 (http://www.ncbi.nlm.nih.gov/nuccore/KF780584.1).

Структура и объем диссертации. Диссертационная работа изложена на 160 страницах печатного текста и состоит из введения, обзора литературы, материалов и методов исследования, результатов собственных исследований и их обсуждений, заключения, выводов, приложений и списка использованных литературных источников. Диссертация иллюстрирована 16 таблицами и 30 рисунками. Список литературы содержит 519 источников, в том числе 32 отечественных и 487 зарубежных авторов.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

Оценка состава микрофлоры полости рта здоровых детей и детей с онкогематологическими заболеваниями в стадии ремиссии Изучение состава микрофлоры ротовой полости здоровых детей и детей с онкогематологическими заболеваниями в стадии ремиссии проводили в одинаковых условиях. Установлено, что идентифицированные нами морфотипы принадлежат к культивируемым и "пока не культивируемым" бактериям. При этом были выявлены грамположительные и грамотрицательные кокки (стрепто-, стафило- и диплококки различных размеров, а также тетрады), палочки (одиночные и диплобактерии различной величины и формой концов, коринеформные); ветвистые, изогнутые и извитые бактерии, плеоморфные микроорганизмы и клетки дрожжеподобных грибов.

В исследуемом материале грамположительные кокки преобладали над остальными формами в обеих группах. Клетки дрожжеподобных грибов встречались в половине мазков из слюны детей с онкогематологическими заболеваниями в стадии ремиссии и не встречались у здоровых детей. В слюне здоровых детей было выявлено большее разнообразие морфотипов бактерий, так же у них чаще встречались ветвистые и извитые формы, коккобациллы и грамотрицательные кокки.

При получении смешанных полимикробных сообществ на питательной среде мы использовали ранее описанные методы (Tetz V.V. et al., 1999; 2004). При высевах исследуемого материала на питательные среды были получены многочисленные смешанные бактериальные сообщества (Takeshita T., Yoshihisa Y., 2012). По морфологии данные сообщества были похожи на обычные изолированные колонии, образованные бактериями одного вида (Tetz V.V. et al., 1997). Микроскопия мазков, приготовленных из этих колоний, показала, что каждая из них содержит от 2 до 8 различных бактерий. В результате последовательных рассевов часть смешанных сообществ удалось разделить и получить из них чистые культуры бактерий, пригодные для идентификации. В тоже время, большинство смешанных бактериальных сообществ, в использованных условиях, разделить не удалось. При выращивании на разных средах в сообществах часто наблюдалось изменение соотношения количества бактерий с разными морфотипами. Некоторые бактерии переставали выявляться при микроскопии. Следует отметить, что мазок делали на всю поверхность предметного стекла, чтобы получить возможность просмотреть большое количество полей зрения и убедиться в морфологической однородности полученной культуры. В таких условиях было выявлено, что часто культура, которую можно было бы считать чистой, содержала несколько морфотипов бактерий. Не редко, попытка разделить смешанные сообщества приводила к полному прекращению роста. В тоже время, некоторые сообщества не меняли своего состава при многократных (более десяти) пересевах. Так же были получены стойкие микробные сообщества, в которых бактерии росли только вместе друг с другом.

Бактерии, входящие в состав таких сообществ, не удалось получить в виде чистых культур. Это можно объяснить выраженной взаимозависимостью микробов, при которой внутри сообществ происходит обмен жизненно важными факторами, которые тот или иной микроорганизм не в состоянии продуцировать сам и отсутствуют в использованных питательных средах. Очевидно, что такие бактерии относятся к “пока не культивируемым”, поскольку имеющиеся методы не позволяют воспроизвести все условия, требующиеся данным микроорганизмам для роста в виде чистых культур.

Некоторые бактерии росли только в присутствии грибов. Такой симбиоз хорошо известен. Взаимодействие между грибами и патогенными бактериями привлекает большое внимание учёных, поскольку такие сообщества особенно устойчивы к воздействию противомикробных препаратов (Morales D.K., Hogan D.A., 2010).

Изучение разнообразия морфотипов бактерий в исследуемом материале позволяет сформировать представление о соотношении выявленных при микроскопии форм микроорганизмов с разнообразием видов, полученных в дальнейшем в результате культивирования. По результатам сравнения числа видимых и культивируемых бактерий в слюне здоровых и больных детей можно заключить, что удалось изолировать в виде чистых культур не более 10% от бактерий, выявленных при микроскопии. Ещё около 20% микроорганизмов были обнаружены в мазках, приготовленных из смешанных сообществ. Получить эти бактерии в виде чистых культур и провести их идентификацию не удалось. Таким образом, около 70% микроорганизмов, выявленных при микроскопии, можно отнести к “пока не культивируемым”, что соответствует современным результатам, полученным при аналогичных исследованиях (Stewart E.J., 2012). Образование на питательных средах большого числа разнообразных смешанных микробных сообществ является ярким свидетельством существования в микрофлоре ротовой полости здоровых и больных детей тесного взаимодействия между различными неродственными микроорганизмами.

Путём рассева смешанных микробных сообществ, полученных из слюны здоровых и больных детей, удалось выделить в виде чистых культур и идентифицировать представителей 23 родов микроорганизмов. Среди них, 8 родов аэробных, 14 родов анаэробных бактерий и представители дрожжеподобных грибов рода Candida (рисунок 1, 2, 3, 4).

–  –  –

Рисунок 1 - Бактерии, выделенные из слюны здоровых детей.

Рисунок 2 – Аэробные бактерии, выделенные из слюны обеих групп детей.

Рисунок 3 – Анаэробные бактерии, выделенные из слюны обеих групп детей.

–  –  –

Рисунок 5 - Микроорганизмы, выделенные из слюны детей с онкогематологическими заболеваниями в стадии ремиссии.

Выделенные нами бактерии получены из смешанных микробных сообществ, которые, очевидно, являются основной формой существования бактерий микробиоты ротовой полости. Поскольку в сообществах формируются условия для облегчённого обмена генетической информацией, в том числе, и генами, отвечающими за устойчивость к противомикробным препаратам, определение чувствительности к антибиотикам микроорганизмов, идентифицированных в слюне, позволяет сформировать представление о распространённости резистентности микрофлоры у здоровых и больных детей. Полученные результаты свидетельствуют о существовании различий распространения антибиотикоустойчивости в микрофлоре в этих двух группах детей. Вероятно, это связано с длительным применением противомикробных препаратов у детей с онкогематологическими заболеваниями в период лечения. Сравнение антибиотикочувствительности штаммов, изолированных из микрофлоры ротовой полости здоровых детей и детей с онкогематологическими заболеваниями в стадии ремиссии, показало повышенное содержание устойчивых клонов среди последних. Так, в микрофлоре больных детей были бактерии, устойчивые к таким антибиотикам как амикацин, меропенем, эритромицин, рокситромицин, которые не встречались в микрофлоре здоровых детей. Следует отметить, что распространение генов антибиотикоустойчивости среди представителей нормальной микрофлоры представляет потенциальную опасность, поскольку, известно, что в состав нормальной микрофлоры входят и условнопатогенные микроорганизмы.

Выявление и генетическая идентификация ранее неизвестного микроорганизма Среди сообществ, полученных из слюны шести детей с онкогематологическими заболеваниями в стадии ремиссии, были выявлены микробные сообщества, в которых преобладали грамположительные кокки. В связи с их стабильностью, появилась возможность более детального изучения их состава. При помощи лазерной микродиссекции собраны образцы данных бактерий, выделена ДНК и методом ПЦР получены копии гена, кодирующего 16S рРНК, которые были секвенированы. После сборки секвенированных генов и их выравнивания установлено, что все образцы, содержащие ДНК грамположительных кокков, имеют идентичную последовательность гена 16S рРНК. При сравнении нуклеотидной последовательности гена 16S рРНК с базой референсных сиквенсов refseq_rna NCBI (National Center for Biotechnology Information) выявлено сродство данных бактерий с некоторыми стрептококками, в частности, Streptococcus oralis (Uo5) FR720602, Streptococcus mitis (B6) FN568063, Streptococcus pneumoniae (R6) AE007317, Streptococcus pseudopneumoniae IS7493 CP002925.

Для проведения филогенетического анализа были построены дендрограммы, отражающие сродство грамположительных стрептококков, выделенных из сообществ, полученных из слюны шести детей с онкогематологическими заболеваниями в стадии ремиссии, с различными микроорганизмами, находящимися в базе refseq_rna (NCBI). В результате изолированный микроорганизм был отнесён к роду Streptococcus, однако видовую принадлежность точно установить не удалось.

Накопившиеся за последние годы в международных базах данные, как оказалось, включают значительное количество непроверенных и недостаточно идентифицированных с позиций микробиологии микроорганизмов. В результате одни и те же последовательности могут быть отнесены к совершенно различным бактериям. В этой связи, стали формироваться «тематические» базы данных, куда включаются только более проверенные результаты исследований и закрыт свободный доступ для размещения исследователями своих результатов. Такой специализированной базой данных для представителей микробиоты ротовой полости является HOMD (Human Oral Microbiome Database – микробиом полости рта человека), признанной наиболее полным ресурсом о составе микрофлоры полости рта. Исходя из этого, мы также определили сродство полученных нами кокков к различным стрептококкам, имеющимся в базе HOMD. Наиболее близкородственным оказался некультивированный Streptococcus sp. HOT_487 Entrez Link AY349414.

Поскольку при филогенетическом анализе изучаемый микроорганизм отличался от наиболее близкородственных, мы выбрали 7 микроорганизмов, максимально родственных изучаемому микробу, и проанализировали их нуклеотидный состав. В результате во всех частях молекулы ДНК выявлены отличия нуклеотидного состава, в том числе, в первых пятистах парах нуклеотидов (полная длина гена 16S рРНК, составляет около 1500 п.н.), так как этот участок является консервативным.

Полученные данные свидетельствуют о существовании значимых отличий, которые характерны для представителей разных видов.

Для выделения чистых культур бактерий, входящих в состав сообществ, полученных из слюны детей с онкогематологическими заболеваниями в стадии ремиссии, применяли набор различных методик (модификация среды, длительное культивирование, титрование до истощения (Vartoukian S.R. et al., 2010; Wang Y. et al., 2009; Song J. et al., 2009). Кроме того, в этих условиях было использовано культивирование на различных питательных средах (кровяной агар, колумбийский агар, колумбийский агар с эритроцитами барана, сывороткой лошади), а также культивирование как в аэробных условиях, так и при повышенном содержании СО2 (5%). В результате из одного из исследуемых сообществ удалось получить чистую культуру грамположительных кокков. Оптимальной средой для культивирования данных грамположительных кокков оказался Колумбийский агар с добавлением эритроцитов барана и лошадиной сыворотки. Рост наблюдался на вторые сутки при температуре 37°С в аэробных условиях и при повышенном содержании СО2. Колонии данных бактерий мелкие, диаметром до 1 мм, правильной круглой формы, шарообразно приподнятые в центре, почти прозрачные, с едва заметным сероватым оттенком и просветлением на границе приподнятой и плоской частей, край несколько неоднородный, отмечалось присутствие прозрачного блестящего тонкого слоя покрывающего колонию (рисунок 5). Консистенция колоний однородная, упругая, поверхность блестящая. Колонии с усилием отделялись от питательного агара, оставляя заметный след. При культивировании на Колумбийском агаре с добавлением эритроцитов под скоплением колоний наблюдалась зона сплошного, мутного, беловато-зеленоватого гемолиза.

Рисунок 5 - Изолированные колонии грамположительных кокков, выделенных из сообществ, полученных из слюны детей с онкогематологическими заболеваниями в стадии ремиссии, при культивировании на Колумбийском агаре с добавлением эритроцитов барана.

По данным световой микроскопии эти бактерии представляют собой относительно крупные грамположительные кокки (рисунки 6 а, б). Кокки имеют овальную форму, расположены одиночно, парами или цепочками, состоящими из трёх – четырёх бактерий. При электронной микроскопии, выполненную методом негативного контрастирования, подтверждено, что бактерии, имеют круглую или овальную форму, с типичным для грамположительных бактерий строением клеточной стенки, выраженным слоем пептидогликана и микрокапсулой.

Полученная чистая культура штамма грамположительных бактерий получила обозначение VT 162. Бактерии идентифицированы как относительно крупные грамположительные кокки, плохо растущие на питательных средах, образующие мелкие колонии и дающие гемолиз на среде с эритроцитами.

Рисунок 6 - a) микрофотография (увеличение 1600 х), б) электронограмма грамположительных кокков, полученных из чистой культуры сообществ, выделенных из слюны детей с онкогематологическими заболеваниями в стадии ремиссии Исследования биохимических свойств выделенного штамма бактерий проводились рутинными микробиологическими методами, а также при помощи системы Vitek 2 (bioMerieux) с использованием идентификационной карты GP (грамположительные кокки). Протеомный анализ проводили с использованием MALDI-TOF масс-спектрометра Bruker BioTyper (Bruker Corporation, США).

При первичном исследовании система Vitek 2 определила схожесть изолированного нами микроорганизма с Granulicatella adiacens, а система Bruker BioTyper – со Streptococcus oralis DSM 20627T, при этом, обе системы указывали на низкую достоверность дискриминации, не позволяющую идентифицировать микроб.

Столь выраженные различия в результатах идентификации этими двумя системами, низкая достоверность дискриминации и несоответствие полученных данных результатам филогенетического анализа, а также сведения о том, что многократная повторная идентификация повышает надёжность результата, стали основой для реидентификации с применением систем Vitek 2 и Bruker BioTyper. Для повторных исследований использовали двухдневную культуру, выращенную в условиях с повышенным содержанием СО2 (5%) на Колумбийском агаре с добавлением (лошадиной сыворотки и эритроцитов барана). Одновременно проводили повторное секвенирование гена, кодирующего 16S рРНК. При этом, материал на все три исследования отбирали одновременно с одной и той же чашки. Таким образом, можно было быть уверенными, что бактерии, идентифицируемые при помощи этих двух систем и по сиквенсу гена 16S рРНК, идентичны и аналогичны исходно полученному варианту. В результате повторных исследований этот микроб был с разной степенью вероятности идентифицирован как Streptococcus pluranimalium (89%), Streptococcus mitis / Streptococcus oralis (89%), Low discrimination organism (дважды), а системой Bruker Biotyper, как Streptococcus oralis, Streptococcus pneumoniae (трижды). По данным сиквенса 16S рРНК микроб точно идентифицировать не удалось. В результате проведённого исследования вновь не удалось получить достоверные данные, позволяющие идентифицировать выделенный нами микроб. Проблемы с идентификацией при использовании существующих методов уже стали предметом обсуждения специалистов. Тесные взаимоотношения между Streptococcus pneumoniae и стрептококками группы Mitis, в частности, Streptococcus mitis и Streptococcus oralis давно известны. У этих трёх видов сиквенс гена 16S рРНК совпадает на 99%, хотя сходство сиквенсов полных геномов этих бактерий составляет приблизительно 60%. Описана межвидовая рекомбинация с участием этих трёх видов, в частности, относительно гена Pbp (penicillin binding protein, пенициллин-связывающий белок).

Следовательно, полученные данные указывают на родственные отношения штамма VT 162 и бактерий рода Streptococcus. В тоже время, поскольку идентификация с использованием систем Vitek 2 и Bruker Biotyper оказалась недостоверной, а филогенетический анализ не давал чёткой видовой идентификации, а так же, учитывая расхождения в последовательностях гена 16S рРНК у штамма VT 162 с близкородственными бактериями, было принято решение о проведении секвенирования всего генома этого штамма.

Для получения ДНК, пригодной для полного секвенирования генома, бактерии были выращены на плотной среде (Колумбийский агар с эритроцитами барана).

Культура была оценена по характеру роста, чистоте и морфологии клеток методами световой микроскопии колонии и мазков. Далее бактерии собирали с поверхности агара платиновой петлей, и затем выделяли ДНК фенол-хлороформным методом.

Полученную ДНК хранили до исследования при температуре -20°С.

Секвенирование проводили на секвенаторе Illumina HiSeq 2500, согласно рекомендациям производителя. В результате было получено 16,79 миллиона однонаправленных последовательностей длиной в 51 нуклеотид. Перекрытие каждого прочтения, в среднем, составляло 345 Х (т.е. каждый из участков был секвенирован 345 раз). Сборку контигов проводили с помощью программы Velvet v 1.2.10. В результате получено 340 контигов. Контиг N50 равен 41,108 п.н., контиг с максимальной длинной равен 115,694 п.н. Сборку контигов в скаффолды и их ориентацию, проводили с использованием программы Mauve aligner v 2.3.1.

Поскольку сборка генома с использованием референсного близкородственного микроорганизма позволяет избежать ошибок, связанных с появлением химер, и избежать использования повторяющихся сиквенсов в качестве последовательностей, связывающих между собой контиги, приводя к реорганизации генома, а так же максимально увеличивает использования всех секвенированных последовательностей, что позволяет получить максимально полный геном, сборка производилась с использованием генома Streptococcus oralis Uo5 (Reichmann P. et al., 2011). В результате был получен геном размером 2,045,418 п.н. с содержанием G+C pавным 41,1%, который аннотирован двумя методами - вручную и с помощью специальной программы и зарегистрирован в NCBI под номером CP007628 (http://www.ncbi.nlm.nih.gov/nuccore/CP007628.1).

В геноме бактерий штамма Streptococcus sp. VT 162 выявлено: 1,935 белок кодирующих последовательностей со средней длинной 909 п.н., 34 тРНК, 3 рРНК, 1 нкРНК. Геном содержит 10 генов кодирующих компетентность (comE, comB, coiA, cglB, cglA, comF, celA, comGF, cglD, comGC), рекомбиназы rarA, rmuC, recA, recF, recO, recN, биосинтеза капсулы cpsC и cpsI, гены белков транспортеров, ассоциированных с полирезистентностью к противомикробным препаратам семейств ABC, MATE, MFS, DMT, ген vanZ, связанный с устойчивостью к тейкопланину (антибиотик, относящийся к группе гликопептидов), бета-лактамаза класса А, фактор вирулентности MviN, адгезины и экзотоксин - гемолизин III.

Полученные результаты указывают, что в геноме бактерий штамма VT 162 содержатся гены, присущие патогенным и условно-патогенным бактериям, кодирующие гемолизин, адгезины и антибиотикоустойчивость. Обращает на себя внимание наличие большого числа генов, кодирующих устойчивость к широкому спектру антимикробных препаратов, включая сравнительно редко применяемые пептидные препараты, типа тейкопланина. Эти данные позволяют предполагать, что данный штамм персистирует и передаётся среди больных, скорее всего, находящихся на стационарном лечении.

Гибридизация ДНК проводится для выявления различий между геномами сравниваемых организмов. В последние годы появились компьютерные алгоритмы, позволяющие провести виртуальную ДНК-ДНК гибридизацию. Данные алгоритмы были разработаны для облегчения и повышения точности исследований, поскольку обычная гибридизация является труднодоступной методикой, подверженной появлению различных ошибок. Результаты выполненной в данной работе виртуальной ДНК-ДНК гибридизации с близкородственными штаммами свидетельствуют о сходстве изолированного штамма со стрептококками (таблица 1).

Таблица 1. Результаты виртуальной ДНК-ДНК гибридизации с близкородственными штаммами.

РДДГ геном Исследуемый Референсный ВДДГ ДИ** ЭУГ*** = геном геном 70%**** Streptococcus WGS oralis ATCC 59.60% 0.0523 50.94% фрагменты 3.250087

–  –  –

Streptococcus WGS 56.80% 0.0574 41.34% 3.203977 oralis strain SK141 фрагменты

Примечание:

*ВДДГ – виртуальная ДНК-ДНК гибридизация с использованием математической модели **ДИ – доверительный интервал ***ЭУГ – эволюционная удалённость геномов ****РДДГ /= 70% - реальная ДНК-ДНК гибридизация. Вероятность того, что ДНК-ДНК гибридизация, проведённая в лаборатории, покажет 70% идентичность геномов (т.е. геномы принадлежат одному виду).

Степень идентичности сравниваемых геномов оценена методом определения "Усреднённая идентичность нуклеотидов", основанном на специальном компьютерном алгоритме. Данная методика также является альтернативой гибридизации ДНК.

Таким образом, результаты исследований указывают на то, что, несмотря на сходство полученного нами штамма VT 162 и бактерий рода Streptococcus, степень различий с наиболее близкородственными видами стрептококков свидетельствует о том, что выделенный нами микроорганизм представляет собой новый, не описанный ранее вид бактерий этого рода.

Определение чувствительности к антибиотикам бактерий штамма VT 162 проводили диско-диффузионным методом. При использовании стандартной методики микроорганизм оказался чувствительным ко всем испытуемым препаратам.

Одновременно в геноме этих бактерий имеются гены полирезистентности и устойчивости к гликопептидам. Эти данные указывают на отсутствие направленной селекции при использованной терапии, как это бывает, когда бактерия идентифицирована как причина патологического состояния.



Pages:   || 2 |

Похожие работы:

«УСАЧЕВ ИВАН ИВАНОВИЧ Микробиоценоз кишечника, его оценка и контроль у овец, целенаправленное формирование у новорожденных ягнят 06.02.02 – ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология Автореферат диссертации на соискание ученой степени доктора ветеринарных наук Москва-2014 Работа выполнена в ФГБОУ ВПО «Брянская государственная сельскохозяйственная академия», на кафедре терапии, хирургии, ветеринарного акушерства и...»

«Герасимов Максим Александрович Аэрозольная санация воздушной среды кролиководческих помещений при профилактике респираторных заболеваний кроликов 06.02.05ветеринарная санитария, экология, зоогигиена и ветеринарносанитарная экспертиза АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Москва 2015 Работа выполнена ФГБОУ ВПО «Московская государственная сельскохозяйственная академия ветеринарной медицины и биотехнологии им. К.И. Скрябина» на кафедре...»

«Курбонов Косим Муродович СОВРЕМЕННЫЕ ЭПИЗООТОЛОГО-ЭПИДЕМИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ И НАДЗОР ЗА БРУЦЕЛЛЕЗОМ В РЕСПУБЛИКЕ ТАДЖИКИСТАН 14.02.02 – эпидемиология Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва – 2015 Работа выполнена в Таджикском научно-исследовательском институте профилактической медицины Министерства здравоохранения и социальной защиты населения Республики Таджикистан Научные руководители: Доктор медицинских наук, профессор...»

«Шемякина Ирина Игоревна Красные и дальне-красные флуоресцентные белки, оптимизированные для мечения белков слияния Специальность03.01.03молекулярная биология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва, 2015 год Работа выполнена в лаборатории геномики адаптивного иммунитета Федерального государственного бюджетного учреждения науки Института биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова Российской академии...»

«Шапурко Валентина Николаевна РЕСУРСЫ И ЭКОЛОГИЧЕСКОЕ КАЧЕСТВО ЛЕКАРСТВЕННЫХ РАСТЕНИЙ (НА ПРИМЕРЕ БРЯНСКОЙ ОБЛАСТИ) Специальность 03.02.08 – Экология (биологические науки) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Брянск 2014 Работа выполнена на кафедре экологии и рационального природопользования ФГБОУ ВПО «Брянский государственный университет имени академика И.Г. Петровского» доктор сельскохозяйственных наук, профессор Научный...»

«Цвиркун Ольга Валентиновна ЭПИДЕМИЧЕСКИЙ ПРОЦЕСС КОРИ В РАЗЛИЧНЫЕ ПЕРИОДЫ ВАКЦИНОПРОФИЛАКТИКИ. 14.02.02 эпидемиология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора медицинских наук Москва – 2014 Работа выполнена в Федеральном бюджетном учреждении науки « Московский научно-исследовательский институт эпидемиологии и микробиологии им. Г.Н. Габричевского» Роспотребнадзора Научный консультант: Заслуженный деятель науки РФ, профессор, доктор медицинских наук Ющенко...»

«Гривенная Елена Николаевна МОНИТОРИНГ КАЧЕСТВА ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ В СИСТЕМЕ МВД РОССИИ С ИСПОЛЬЗОВАНИЕМ РЕЙТИНГОВЫХ ТЕХНОЛОГИЙ 13.00.08 – Теория и методика профессионального образования Автореферат диссертации на соискание ученой степени доктора педагогических наук Краснодар – 2015 Работа выполнена в ФГКОУ ВПО «Краснодарский университет Министерства внутренних дел Российской Федерации». Научный доктор педагогических наук, профессор консультант: Ганченко...»

«ВАНГЕЛИ СЕРГЕЙ ВАЛЕРЬЕВИЧ СРАВНИТЕЛЬНАЯ УЛЬТРАСТРУКТУРНАЯ ХАРАКТЕРИСТИКА КУЛЬТУР КЛЕТОК, ХРОНИЧЕСКИ ИНФИЦИРОВАННЫХ ВИРУСОМ ЛЕЙКОЗА КРУПНОГО РОГАТОГО СКОТА 06.02.02 – ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология Автореферат диссертации на соискание ученой степени кандидата ветеринарных наук Москва – 201 Работа выполнена в Федеральном государственном бюджетном научном учреждении научно-исследовательский институт...»

«Ильина Елена Петровна Незаконная добыча (вылов) водных биологических ресурсов (по материалам Камчатского края) 12.00.08 – Уголовное право и криминология; уголовно-исполнительное право Автореферат диссертации на соискание ученой степени кандидата юридических наук Москва – 2015 г. Работа выполнена в федеральном государственном бюджетном образовательном учреждении высшего профессионального образования «Московский государственный юридический университет имени О.Е. Кутафина...»

«АЛЕКСЕЕВА Татьяна Васильевна БИОТЕХНОЛОГИЧЕСКИЙ ПОТЕНЦИАЛ ФРАКЦИЙ ГЛУБОКОЙ ПЕРЕРАБОТКИ НИЗКОМАСЛИЧНОГО СЫРЬЯ: БАЛАНСИРОВАНИЕ ПНЖК СОСТАВА, ПРОГНОЗИРОВАНИЕ КАЧЕСТВА, НОВЫЕ ТЕХНОЛОГИИ Биотехнология пищевых продуктов и биологических 05.18.07 – активных веществ Технология и товароведение пищевых продуктов 05.18.15 – и функционального и специализированного назначения и общественного питания АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора технических наук Воронеж Работа...»

«ДОБРЕНЬКОВ ДМИТРИЙ СЕРГЕЕВИЧ ХАРАКТЕРИСТИКА БИОЦЕНОТИЧЕСКИХ ОТНОШЕНИЙ БАКТЕРИАЛЬНЫХ СООБЩЕСТВ ПОЛОСТИ РТА И МИКРОЭКОЛОГИЧЕСКОЕ ОБОСНОВАНИЕ ПРИНЦИПОВ БИОКОРРЕКЦИИ 03.02.03 – Микробиология Автореферат диссертации на соискание ученой степени кандидата медицинских наук Волгоград Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования «Волгоградский государственный медицинский университет» Министерства здравоохранения...»

«Нгуен Тхи Тху Ха МЕДОНОСНЫЕ РЕСУРСЫ ЛЕСНОГО ФОНДА ЛЕНИНГРАДСКОЙ ОБЛАСТИ И ЦЕНТРАЛЬНОГО ВЬЕТНАМА 06.03.02 Лесоведение, лесоводство, лесоустройство и лесная таксация АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург 2015 ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ Актуальность темы исследования. Использование недревесных ресурсов вносит существенный вклад в улучшение качества жизни населения многих стран, включая Россию и Вьетнам. До настоящего...»

«САГИТОВА МИНЗИЛЯ ГАБДУЛХАЕВНА ГИГИЕНИЧЕСКОЕ ОБОСНОВАНИЕ ПРИМЕНЕНИЯ ПОЛИСАХАРИДА «ГРАМО» В ПТИЦЕВОДСТВЕ 06.02.05 ветеринарная санитария, экология, зоогигиена и ветеринарно-санитарная экспертиза АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Казань – 2015 Работа выполнена в условиях кафедры зоогигиены федерального государственного бюджетного образовательного учреждения высшего профессионального образования «Казанская государственная академия...»

«СЕТДЕКОВ РИНАТ АБДУЛХАКОВИЧ РАЗРАБОТКА НОВЫХ СРЕДСТВ СПЕЦИФИЧЕСКОЙ ПРОФИЛАКТИКИ И ЛЕЧЕНИЯ ЭШЕРИХИОЗОВ ТЕЛЯТ И ПОРОСЯТ 06.02.02 – ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора ветеринарных наук Казань 2015 Работа выполнена в отделе биологической безопасности Федерального государственного бюджетного учреждения «Федеральный центр токсикологической, радиационной и...»

«Овчинникова Зинаида Алексеевна ГИГИЕНИЧЕСКАЯ ОЦЕНКА ВЛИЯНИЯ УСЛОВИЙ ОБУЧЕНИЯ НА ЗДОРОВЬЕ ШКОЛЬНИКОВ МЕДИКО-БИОЛОГИЧЕСКИХ КЛАССОВ 14.02.01 – гигиена Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва 2015 Работа выполнена на кафедре гигиены государственного бюджетного образовательного учреждения высшего профессионального образования «Российский национальный исследовательский медицинский университет им. Н. И. Пирогова» Минздрава России Научный...»

«Фирстова Виктория Валерьевна Экспериментально-иммунологическое обоснование выбора стратегии оценки поствакцинального иммунитета против чумы и туляремии 14.03.09 Клиническая иммунология, аллергология АВТОРЕФЕРАТ диссертация на соискание ученой степени доктора биологических наук Оболенск 2015 Работа выполнена в ФБУН «Государственный научный центр прикладной микробиологии и биотехнологии» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека...»

«ОВСЯННИКОВ Алексей Юрьевич СЕЗОННАЯ СТРУКТУРНО-ФУНКЦИОНАЛЬНАЯ ТРАНСФОРМАЦИЯ ФОТОСИНТЕТИЧЕСКОГО АППАРАТА ХВОИ PICEA PUNGENS ENGL. И P. OBOVATA LEDEB. НА ТЕРРИТОРИИ БОТАНИЧЕСКОГО САДА УРО РАН (Г. ЕКАТЕРИНБУРГ) 03.02.08 — «Экология (в биологии)» Автореферат диссертации на соискание учёной степени кандидата биологических наук Санкт-Петербург Работа выполнена в Федеральном государственном бюджетном учреждении науки Ботанический сад Уральского отделения Российской академии наук...»

«Шкаленко Вера Владимировна РАЗРАБОТКА МЕТОДОВ ИНТЕНСИФИКАЦИИ ПРОИЗВОДСТВА КОНКУРЕНТОСПОСОБНОЙ ПРОДУКЦИИ СВИНОВОДСТВА ЗА СЧЕТ ОПТИМИЗАЦИИ ГЕНОТИПИЧЕСКИХ И ПАРАТИПИЧЕСКИХ ФАКТОРОВ В УСЛОВИЯХ ПРОМЫШЛЕННЫХ КОМПЛЕКСОВ 06.02.10 – частная зоотехния, технология производства продуктов животноводства АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Волгоград – 2015 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего...»

«ШАХТАМИРОВ Иса Янарсаевич КАРИОПАТОЛОГИЯ У ЖИВОТНЫХ В ЗОНАХ СТОЙКИХ ОРГАНИЧЕСКИХ ЗАГРЯЗНИТЕЛЕЙ ВНЕШНЕЙ СРЕДЫ 03.02.07 – генетика АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Санкт-Петербург Работа выполнена в Федеральном государственном бюджетном учреждении высшего профессионального образования «Чеченский государственный университет» Научный консультант: доктор биологических наук, профессор Кравцов Вячеслав Юрьевич Официальные оппоненты:...»

«Баянов Николай Георгиевич ОПЫТ ЭКОЛОГИЧЕСКОГО МОНИТОРИНГА КАРСТОВЫХ И ПОЙМЕННЫХ ОЗЁР В ЗАПОВЕДНИКАХ РОССИИ (НА ПРИМЕРЕ ПИНЕЖСКОГО И КЕРЖЕНСКОГО ЗАПОВЕДНИКОВ) 03.02.08 – экология Автореферат диссертации на соискание ученой степени доктора биологических наук Петрозаводск – 2015 Работа выполнена в Федеральном государственном бюджетном учреждении Государственный природный биосферный заповедник «Керженский» доктор географических наук Научный консультант Бобровицкая Нелли...»







 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.