WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 


Pages:     | 1 | 2 || 4 | 5 |   ...   | 7 |

«ИДЕНТИФИКАЦИЯ И АНАЛИЗ ВЗАИМОДЕЙСТВИЯ ПРИОНОВ И АМИЛОИДОВ В ПРОТЕОМЕ ДРОЖЖЕЙ SACCHAROMYCES CEREVISIAE ...»

-- [ Страница 3 ] --

также рис.2). При инициации приона определнные последовательности белка формируют кросс-бета структуру, стабилизированную межмолекулярными водородными связями. Пространственная укладка этих последовательностей в виде «арок», поперечных оси протофибриллы, определяется расположением амилоидогенных трактов и их размером. У некоторых прионов могут реализовываться различные варианты укладки, что зависит от того, какие последовательности взаимодействуют на этапе инициации прионогенеза. На этапе элонгации структура приона остатся неизменной. Молекулы других прионых белков имеют иную аминокислотную последовательность и содержат иные амилоидогенные тракты, что препятствует присоединению к чужой матрице и способствует взаимодействию с собственной прионной протофибриллой.

В некоторых случаях различные прионы вступают в антагонистические отношения. Так, при скрещивании штаммов [PSI+] и [URE3] диплоиды теряют тот или иной прион [Schwimmer, Masison, 2002]. Следует упомянуть о том, что некоторые варианты [PIN+] оказывают дестабилизирующее воздействие на слабые варианты [PSI+] [по: Derkatch, Liebman, 2007]. В штаммах, содержащих одновременно три приона - [PSI+][PIN+] и [SWI+], последний элиминируется с высокой частотой [Du and Li, 2014]. Механизмы антагонистического влияния прионов не изучены. Можно предположить, что некоторые прионные варианты одного белка могут блокировать рост (элонгацию) прионных конформеров другого белка. Вполне вероятно также, что влияние прионов на стабильность друг друга может быть опосредовано изменением активности других компонентов протеомных сетей.

Неинфекционные амилоиды, в отличие от прионов, не фрагментируются и, вследствие этого, не наследуются, однако они могут способствовать индукции прионов и, таким образом, вовлекаться в регуляцию эпигенетических событий у одноклеточных организмов. Так, мутантная последовательность белка Хангтингтина человека (Q103) при сверхпродукции в дрожжевых штаммах [PIN+] формирует амилодоподобные агрегаты, что значительно повышает частоты индукции приона [PSI+] [Derkatch et al., 2004]. Кроме того, амилоид Q103 в дрожжах индуцирует формирование детергент-устойчивых агрегатов Rnq1, Def1 и Bmh1 [Urakov et al., 2010; Duennwald et al., 2006; Wang et al., 2007].

Возникновение прионов также может провоцировать индукцию неинфекционных амилоидов. Так, белок Pub1 при сверхпродукции формирует детергентустойчивые агрегаты в штаммах [PSI+], но не в штаммах [psi-]. Без сверхпродукции в штаммах [PSI+] белок Pub1 также выявляется во фракции высокомолекулярных агрегатов, но лишь в следовых количествах [Urakov et al., 2010].

Сходные взаимодействия отмечены и для амилоидогеных белков млекопитающих. В частности, мономеры PrPС связывают амилоидные агрегаты A и -синуклеина, которые выявляются в головном мозге в случаях болезней Альцгеймера и Паркинсона, соответственно [Majd et al., 2013]. Более того, прионные конформеры PrPSc инициируют агрегацию пептида A, образующего амилоиды при болезни Альцгеймера [Schwarze-Eicker et al., 2005]. Агрегация A, а также -синуклеина, вызывает гипперфосфорилирование и олигомеризацию пептида tau, что приводит к развитию нейродегенерации [Rank et al., 2002;

Giasson et al., 2003]. Агрегаты tau, в свою очередь, индуцируют образование амилоидных конформеров -синуклеина [Giasson et al., 2003]. Наиболее полно охарактеризованы взаимодействия PrP и A. Показано, что белок PrP в мономерной изоформе PrPC, заякоренный на мембране нейронов, является рецептором для патогенных олигомеров A [Lauren et al., 2009]. Парадоксально, но факт - белок PrP, конформационные изменения которого вызывают прионные заболевания, в нормальной клеточной изоформе может быть вовлечн в патогенез болезни Альцгеймера. Более того, показано, что олигомеры A индуцируют агрегацию PrP, также как прионные полимеры PrPSc инкорпорируют пептид A и способствуют его агрегации [Morales et al., 2010]. Важно отметить, что физическое связывание PrP и A отмечается лишь в том случае, когда один из этих двух белков представлен в виде амилоидных олигомеров. Мономеры PrP и A друг с другом не взаимодействуют [Freir et al., 2011]. Исходя из этих данных, можно заключить, что взаимодействие провоцирует конформационное изменение одного из партнров. Установлено, что ключевую роль в связывании PrPС с олигомерами A играют положительно заряженные последовательности PrP23–27aa и PrP90–110aa [Fluharty et al., 2013].

Приведнные в этом разделе данные свидетельствуют о том, что предсуществующие амилоидные агрегаты зачастую способствуют индукции амилоидогенеза других белков, но из-за отсутствия методов, позволяющих проводить комплексную идентификацию амилоидов в масштабах протеома, эти данные носят отрывочный характер.

На данном этапе можно лишь заключить, что индукции амилоидогенеза одного белка за счт агрегатов другого способствует сходство исследуемых белков. Кроме того, такого рода взаимодействия не всегда предполагают физическое связывание амилоидогенных белков. Как мы уже упоминали, белок Mod5 в прионной форме не колокализуется с Sup35, но способствует его прионизации. Вероятно, прионизация транскрипционного регулятора Mod5 может вызывать изменения уровня экспрессии целого ряда генов и таким образом влиять на возможность амилоидогенеза соответствующих белков.

Рассматривая последствия амилоидогенеза необходимо помнить, что агрегация одного белка может вызывать целую цепочку событий, изменяющих взаимодействия компонентов протеомной сети. В частности, прионные агрегаты Sup35 секвестрируют мономеры белка Sup45, играющего роль основного фактора терминации трансляции [Paushkin et al., 1997; Gong et al., 2012; Vishveshwara et al., 2009]. Более того, в работе лаборатории Т.Р. Сойдлы было показано, что прионные агрегаты белка Sup35 связывают сорок белков, примерно половину из которых составляют шапероны и белки, регулирующие глюкозный метаболизм [Nevzglyadova et al., 2009]. Таким образом, прионизация одного белка может вызывать глобальные изменения в регуляции протеомных взаимодействий.

Отметим, что прионизация может приводить не только к частичной инактивации белка, но и к приобретению им новых функций. Так, прионные агрегаты Sup35 связывают белки, с которыми мономеры не взаимодействуют Sup35 [Nevzglyadova et al., 2009]. Такую же способность приобретают многие патологические амилоиды млекопитающих [по: Gruschus, 2008]. Кроме того, совсем недавно было показано, что белок Rnq1 клеточные функции которого неизвестны, только в прионной форме вызывает гипперфосфорилирование Pub4 [Yang et al., 2014] и, возможно, других белков. По всей вероятности, наиболее существенное влияние на регуляцию протеомных сетей может оказывать прионизация транскрипционных регуляторов, таких как Isp1, Swi1, Cyc8 и Mod5.

Фундаментальные и методологические проблемы в исследовании 1.6.

прионов и амилоидов Вопрос о распространнности функциональных и патологических прионов и амилоидов у различных организмов и значимости амилоидогенеза по-прежнему остатся открытым. На нынешнем уровне наших знаний невозможно с высокой степенью достоверности предсказать, какие белки обладают амилоидными свойствами in vivo. Наличие потенциально амилоидогенных последовательностей ещ не гарантирует возможность амилоидогенеза белка. Например, Q/Nобогащнная последовательность New1, слитая с М и С доменами Sup35, прионизуется, тогда как полноразмерный белок New1 не обладает прионными свойствами Помимо аминокислотной [Osherovich et al., 2004].

последовательности возможность амилоидогенеза in vivo зависит также от уровня продукции белка, который в свою очередь может меняться. Многофакторный характер регуляции амилоидогенеза препятствует возможности применения биоинформационных алгоритмов для выявления амилоидов. Новые функциональные и патологические амилоиды выявляют не вследствие системного анализа, а в результате направленного изучения свойств отдельных белков или анализа конкретных патологий. У дрожжей прионные белки обычно выявляют в результате генетического скрининга факторов, определяющих фенотипические изменения признака, либо благодаря анализу биохимических свойств белков, имеющих сходство с известными прионами. Такой подход не может дать информацию о масштабах и значимости исследуемого феномена. С нашей точки зрения, существенный прогресс в понимании вопроса о масштабности и значимости амилоидогенеза может быть достигнут за счт использования принципиально новых подходов, позволяющих идентифицировать не отдельные инфекционные и неинфекционные амилоиды, а выявлять и идентифицировать «амилоидом» различных организмов в целом.

Впервые подход для разработки универсального метода идентификации различных амилоидов был предложен в работе наших коллег из лаборатории М.Д.

Тер-Аванесяна [Kushnirov et al., 2006]. Авторы обратили внимание на универсальное биохимическое свойство амилоидных фибрилл – их высокую устойчивость к обработке ионным детергентом додецилсульфатом натрия (SDS).

Очистив высокомолекулярную фракцию SDS-устойчивых белковых полимеров, авторам удалось без помощи антител выявить амилоидные агрегаты белка Sup35NM, но лишь на фоне его сверхпродукции [Kushnirov et al., 2006].

Использование этого подхода в комплексе с современными протеомными методами может позволить разработать универсальный биохимический метод, позволяющий идентифицировать даже минорные белки, формирующие амилоидные агрегаты.

В исследовании взаимодействия прионов и амилоидов также остатся много открытых вопросов. Как мы уже обсуждали, одни амилоиды могут инициировать возникновение других, но чаще всего такие исследования проводят на фоне искусственно вызванной сверхпродукции одного из взаимодействующих белков.

Прионная конверсия транскрипционных регуляторов, таких как Swi1, может вызывать амилоидогенез других белков не только за счт непосредственного взаимодействия с гетерологичной матрицей, но и в результате изменения уровня продукции целого ряда белков. Задача выявления комплексных изменений амилоидома также может быть решена за счт разработки универсального биохимического метода, позволяющего выявлять амилоиды в масштабах протеома.

Несмотря на активные исследования прионных взаимодействий все известные факты сводятся к индукции одним прионом другого. По-прежнему не известно – могут ли взаимодействия прионов, подобно взаимодействиям классических генов, приводить к наследуемым изменениям признаков? Пока такие взаимодействия не описаны. Анализ взаимодействия патологических амилоидов млекопитающих in vivo зачастую представляет собой крайне сложную и дорогостоящую задачу. Многие паталогические амилоидные агрегаты убивают клетки млекопитающих, что крайне затрудняет анализ каких-либо взаимодействий. Эта проблема может быть решена за счт использования адекватных и удобных модельных систем, лишнных перечисленных недостатков.

Целый ряд работ, проведнных в последние годы, убедительно доказывает, что дрожжи S. cerevisiae являются наиболее перспективным модельным объектом для исследования агрегации гетерологичных амилоидогенных белков [Coughlan and Brodsky, 2005; Mason and Giorgini, 2011]. В частности показано, что при продукции в дрожжевой клетке ряд белков млекопитающих формирует агрегаты, обладающие амилоидными характеристиками [Ma and Lindquist, 1999; Meriin et al., 2002; Winderickx et al., 2008; Mallik et al., 2010]. Уровень продукции амилоидных белков в дрожжах легко регулировать за счт использования различных индуцибельных промоторов. Важно отметить, что в дрожжах амилоидогенез начинается практически сразу после запуска продукции соответствующего белка, тогда как в организме млекопитающих процесс формирования амилоидов может длиться месяцы и годы. Кроме того, амилоидные агрегаты белков млекопитающих не убивают дрожжевые клетки, что позволяет разрабатывать различные модельные системы для скрининга факторов, контролирующих процесс амилоидогенеза. На наш взгляд, дрожжи S. cerevisiae представляют собой уникальный модельный объект для исследования взаимодействия гетерологичных амилоидов in vivo.

68

ГЛАВА 2. МАТЕРИАЛЫ И МЕТОДЫ

2.1. Штаммы микроорганизмов, среды и условия культивирования Для культивирования дрожжей использовали стандартные дрожжевые среды [Захаров и др., 1984; Rose et al., 1990]: полные среды YAPD (содержит глюкозу в качестве источника углерода) или СПГ (содержит все компоненты полной среды, за исключением глюкозы, замененной на глицерин (24 мл/л));

минимальные среды – MD (содержит глюкозу в качестве источника углерода), также MG и MGly, содержащие соответственно галактозу и глицерин в качестве источника углерода. В селективные среды на основе MD и MG добавляли витамины, микроэлементы, а также, аминокислоты и азотистые основания производства “Sigma” (США) в следующих концентрациях: аденин – 20мг/л, Lлизин – 30мг/л, урацил – 20мг/л, L-лейцин – 60мг/л, L-триптофан – 20мг/л.

Для индукции споруляции диплоидных штаммов использовали преспоруляционную среду и среду с ацетатом калия.

Использовали также среды модифицированного состава:

среду YAPD с добавлением хлорида гуанидина “QIAGEN” (США) в концентрации 5 мМ;

–  –  –

Для отбора цитодуктантов использовали селективную среду ME, или полную среду YPE, в которых глюкоза заменена на 96 этанол (20мл/л) и добавлен циклогексимид в концентрации 1мг/л. Аминогликозидные антибиотики паромомицин (100 мкг/мл) и генетицин (50 мкг/мл) добавляли в среду для анализа роста дрожжей на фоне общего ингибирования трансляции. Для экспрессии конструкций, находящихся под контролем индуцибельного промотора CUP1, в среды добавляли CuSO4 «РЕАХИМ» (Россия) в концентрациях от 3 до 150 мкМ.

Для культивирования бактерий использовали тврдую и жидкую среды LB (Sambrook et al., 1989). Селекцию устойчивых к ампициллину трансформантов проводили на среде LB с ампициллином в концентрации 50 мкг/мл. Дрожжевые штаммы культивировали при температуре 30С, штаммы бактерий при 37С. В работе использован штамм Escherichia coli DH5 следующего генотипа: supE44 lacU169 (80lacZM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1.

Генотипы штаммов S. cerevisiae приведены в Таблице 4. Диплоидный штамм D931 был получен в результате трансформации штамма GT111 [Chernoff et al., 2000] плазмидой pU-A-Sup35MC. Гаплоидный сегрегант 1-D931 с делецией хромосомной копии гена SUP35, содержащий плазмиду pU-A-Sup35MC, был получен с помощью метода случайной выборки аскоспор. Штамм 1-1-D931 был получен как описано в разделе «3.1.» и содержит прионный детерминант [NSI+].

Штамм 6-1-1-D931 был получен в результате переключения типа спаривания MATa на MAT у штамма 1-1-D931 за счт использования плазмиды YEpHO.

Штамм 4-1-1-D931 получен за счт замены плазмиды pU-A-Sup35MC на pL-ASup35MC в штамме 1-1-D931. Штамм 3-4-1-1-D931 получен за счт замены плазмиды pL-A-Sup35MC на pFL38-SUP35P в штамме 4-1-1-D931. Гаплоидный сегрегант 1-D933 был получен в результате споруляции диполоида D933 и селекции клона нужного генотипа (см. табл. 4). Гаплоидный штамм 2-1-1-1-D931 был получен в результате замены плазмиды pU-A-Sup35MC в штамме 1-1-1D931 на плазмиду pRS315-SUP35MC. Гаплоидные штаммы[nsi-] 1-1-1-D931 [nsi-], 1-4-1-1-D931, 1-3-4-1-1-D931,и 1-2-1-1-D931 и 1-2-D934 были получены в результате трхкратного пассирования штаммов 1-1-D931, 4-1-1-D931, 1-3-4-1-1D931, 2-1-1-D931 и 2-D934, соответственно, на среде с 5mM GuHCl и последующего отбора клонов, утративших способность к росту на селективной среде без аденина. Штамм 2-1-1-D931 получен из штамма 1-1-D931 путм замены плазмиды pU-A-Sup35MC на плазмиду pRS315-SUP35MC. Штаммы 6-1-4-1-1D931 и 7-1-4-1-1-D931, содержащие прионные детерминанты [SWI+] и [PIN+], соответственно, получены в результате трансформации сферопластов штамма 1-4D931 белковым лизатом штамма 1-1-D931 (описание метода белковой трансформации приведено ниже). Штамм 2-4-1-1-D931 [PIN+] получен путм трансформации сферопластов штамма 1-4-1-1-D931 [pin-] белковым лизатом штамма BY4742 [PIN+]. Штамм 2-2-1-1- D931 получен на основе штамма 2-1-1D931 за счт замены плазмиды pRS315-Sup35MC на плазмиду pRS316-Sup35MC.

Штамм 1-2-2-1-1-D931 был получен из штамма 2-2-1-1-D931 в результате замены плазмиды pRS316-Sup35MC на pASB2. Штамм 18-3-2-1-1- D931 получен из штамма 3-2-1-1-D931 в результате замены плазмиды pRS316-Sup35MC на pASB2.

Штаммы 4-2-1-1-D931 [NSI+] и 5-2-1-1-D931 [nsi-] были получены в результате замены плазмиды pRS315-SUP35MC на плазмиду pYCH-U2 в штаммах, 2-1-1D931 [NSI+] и его деривате [nsi-], соответственно.

Штаммы 1-4-2-1-1-D931 и 1-5-2D931 получены из штаммов 4-2-1-1-D931 и 5-2-1-1-D931, соответственно, путем замещения плазмиды pYCH-U2 на плазмиду pNR-ABF1. Гаплоидный штамм 1P-74-D694, содержащий встроенную в хромосому кассету SUP35 P.m.LEU2 вместо последовательности гена SUP35 S. cerevisiae, был описан ранее [Derkatch et al., 2000]. Штаммы 1-D934 и 2-D934 являются гаплоидными сегрегантами штамма D934, полученными с помощью метода случайной выборки аскоспор. Штамм 1-D932 является гаплоидным сегрегантом штамма D932, полученным с помощью метода случайной выборки аскоспор. Штаммы 7-1-1D931, 9-1-1-D931 и 7-4-1-1-D931 были получены в результате замещения последовательности хромосомных копий генов и RNQ1, VTS1 SWI1, соответственно, на последовательность KanMX4, экспрессия которой вызывает устойчивость дрожжевых клеток к антибиотику генетицину.

Таблица 4. Штаммы S.

cerevisiae, использованные в работе Штамм Генотип, эпигенетические детерминанты, описание

–  –  –

Продолжение таблицы 4.

MAT дериват штамма 1-1-1-D931, содержащий плазмиду pL-A-Sup35MC вместо pU-AD931 Sup35MC [SWI+][pin-] дериват штамма 1-4-1-1-Д931 6-1-4-1-1-D931 [swi-][PIN+] дериват штамма 1-4-1-1-Д931 7-1-4-1-1-D931 MATa sup35::HIS3 swi1::KanMX4 ade1-14 his3 leu2 lys2 ura3 trp1-289 [pL-A-Sup35MC] 7-4-1-1-D931 [PIN+] [PIN+] дериват штамма 1-4-1-1-D931 2-4-1-1-D931 Дериват hsp104::LEU2 штамма 1-1-D931 3-1-1-D931 9-1-1-D931 MATa sup35::HIS3 ade1-14 his3 leu2 lys2 ura3 trp1-289 vts1::KanMX [pU-A-Sup35MC] [NSI+] MATa sup35 ::HIS3 ade1-14 his3 leu2 lys2 ura3 trp1-289 [NSI+] [ pRS315-SUP35MC] 2-1-1-D931 [nsi-][pin-] дериват штамма 2-1-1-D931 1-2-1-1-D931 Дериват 2-2-1-1-D931, несущий плазмиду pASB2, [NSI+] 1-2-2-1-1-D931 18-3-2-1-1- D931 MATa sup35::HIS3 ade1-14 his3 leu2 lys2 ura3 trp1-289 [nsi-] [pASB2] MAT sup35::HIS3 ade1-14 his3 leu2 lys2 ura3 trp1-289 [pRS316-Sup35MC] [NSI+][PIN+] 2-2-1-1- D931 MATa sup35::HIS3 ade1-14 his3 leu2 lys2 ura3 trp1-289 [NSI+] [pYCH-U2] 4-2-1-1-D931

Продолжение таблицы 4.

MATa sup35::HIS3 ade1-14 his3 leu2 lys2 ura3 trp1-289 [NSI+] [pNR-ABF1] 1-4-2-1-1-D931 MATa sup35::HIS3 ade1-14 his3 leu2 lys2 ura3 trp1-289 [nsi-] [pYCH-U2] 5-2-1-1-D931 MATa sup35::HIS3 ade1-14 his3 leu2 lys2 ura3 trp1-289 [nsi-] [pNR-ABF1] 1-5-2-1-1-D931 MATa sup35::HIS3 ade1-14 his3 leu2 lys2 ura3 rnq1::KanMX [pU-A-Sup35MC] [NSI+][PIN+] 7-1-1-D931 MATa ade2-28 his3 LEU2 lys 9-21 ura3-525 trp1 cyhR kar1-1 [pin-] 7B-D901 MAT/MATa sup35::HIS3/sup35::HIS3 his3/his3 ade1-14/ade1-14 trp1-298/ trp1-289 lys2/lys2 D933 ura3/ura3 leu2/leu2 [pU-Ab-Sup35MC] [pL-A-Sup35MC] [nsi- ] [PIN+] MAT sup35::HIS3 ade1-14 his3 leu2 lys2 ura3 trp1-289 [pU-A-Sup35MC] [nsi-][PIN+] 1-D933 MATa ade1–14 his3-200 leu2–3,112 lys2–801 trp1–289 ura3–52 [PSI+][PIN+] GT81-1C [psi-][pin-] дериват штамма GT81-1C GT409 MAT his3-1 leu2-0 lys2-0 ura3-0 [psi-][PIN+] BY4742 [pin-] дериват штамма BY4742 1-BY4742 MAT// MATa his3-1//his3 leu2-0// leu2 lys2-0// lys2 ura3-0// ura3 trp1-289//+ ade1-14//+ D955 sup35::HIS3//SUP35 [PIN+] [SWI+] MAT// MATa his3-1//his3 leu2-0// leu2 lys2-0// lys2 ura3-0// ura3 trp1-289//+ ade1-14//+ D956 sup35::HIS3//SUP35 mit1::KANMX4//MIT1 [pL-A-Sup35MC] [PIN+] [SWI+] Продолжение таблицы 4.

–  –  –

MAT sup35::SUP35P_LEU2 ade1-14 his3 leu2 lys2 ura3 trp1 [NSI+] 2-D934 [nsi-][pin-] дериват штамма 2-D934 1-2-D934 MATa sup35::SUP35P_LEU2 ade1-14 his3 ura3-52 leu2-3,112 trp1 1P-74-D694 MATa his31 leu20 met150 ura30 gas1::GAS1-YFP ATCC 201388 GAS1-YFP D934 MATa/MATa sup35::HIS3/sup35::SUP35P_LEU2 his3/his3 ade1-14/ade1-14 trp1-298/trp1 LYS2/lys2 ura3/ura3-52 leu2/leu2-3,112 [pU-A-Sup35MC] [NSI+] D935 MATa/MATa sup35::SUP35P_LEU2/sup35::SUP35P LEU2 his3/his3 ade1-14/ade1-14 trp1/trp1 LYS2/lys2 ura3/ura3-52 leu2/leu2-3,112 [NSI+] D936 MATa/MATa sup35::SUP35P_LEU2/sup35::SUP35P LEU2 his3/his3 ade1-14/ade1-14 trp1/trp1 LYS2/lys2 ura3/ura3-52 leu2/leu2-3,112 [nsi-]

Продолжение таблицы 4.

MAT/MATa SUP35/sup35::HIS3 ADE1/ade1-14 ADE2/ade2-28 HIS3/his3 LEU2/leu2 D932 LYS2/lys2 LYS9/lys 9-21 ura3/ura3-525 trp1/trp1-289 CYH/cyhR KAR1/kar1-1[pL-A-Sup35MC] [nsi=] MAT sup35::HIS3 ade1-14 his3 leu2 ura3 trp1-289 cyhR kar1-1 [rho0] 1-D932 [pL-A-Sup35MC] [nsi-] Примечание. Генотипы приведены в соответствии со стандартной трехбуквенной номенклатурой [Захаров и др. 1984;

Sherman et al., 1986]. Аллель ade1-14 содержит нонсенс-мутацию UGA; trp1-289 – нонсенс-мутацию UAG; ura3-52 – инсерцию дрожжевого мобильного элемента Ty1 в кодирующую часть гена URA3; leu2-3,112 – двойные мутации в гене LEU2.

76 Штамм 3-1-1-D931 был получен в результате замещения последовательности хромосомных копий гена HSP104 в штамме 1-1-D931 на последовательность гена LEU2. 1-D956 – гаплоидный сегрегант штамма D956, полученный с помощью случайной выборки аскоспор.

Штаммы GT81-1C, GT409 и BY4742 были любезно предоставлены проф.

Ю.О. Черновым. 1-BY4742 – [pin-] дериват штамма BY4742. Штамм ATCC 201388 GAS1-YFP, любезно предоставленный А.А. Александровым, содержит интегрированную в хромосому последовательность гена GAS1 под контролем собственного промотора, слитую в рамке с последовательностью гена GFP [Huh et al., 2003]. Штамм 7B-D901 [Saifitdinova et al., 2010] любезно предоставлен Ю.В.

Соповой.

Ниже указан способ получения диплоидных штаммов, используемых вработе:

D933 (1-D931 MATa х 2-1-1-1-D931 MAT); D955 (1-1-D931 MATa х BY4749 MAT); D934 (1P-74-D694 MATa x 6-1-1-D931 MAT); D935 (1-D934 MATa x 2D934 MAT); D936 получен в результате пассирования на среде с GuHCl штамма D935; D932 (7B-D901 MATa x 2-1-1-1-D931 MAT); D956 получен в результате скрещивания штамма 4-1-1-D931 клоном BY4742 mit1:: KanMX4 делеционной дрожжевой библиотеки “BY deletion collection” (Invirtogene, США), созданной на базе штамма BY4742. Клон BY4742 mit1:: KanMX4 из делеционной библиотеки любезно предоставлен проф. Ю.И. Павловым (Небраска, США).

2.2. Плазмиды Плазмида pcDNA3-1-3F4 содержит мышиный ген Prnp, модифицированный для распознавания моноклональными антителами 3F4, а также ориджины, необходимые для репликации плазмиды в E. coli и культурах клеток млекопитающих [Narwa and Harris, 1999].

Все остальные плазмиды представляют собой челночные вектора, имеющие дрожжевые и бактериальные ориджины репликации. Их основные характеристики представлены в таблице 5. Плазмида pRS315 была описана ранее Плазмида содержит [Christianson, et al., 1992]. pmCUPNMsGFP последовательность, кодирующую химерный ген под контролем индуцибельного промотора CUP1 [Serio et al., 1999]. Плазмида pRS316CG, содержащая последовательность гена GFP под контролем промотора CUP1, была описана ранее [Liu 1999]. Плазмида pRS315-SUP45, любезно and Lindquist, предоставленная проф. Г.А. Журавлвой, была описана ранее [Moskalenko et al., 2003]. Плазмида pFL38-SUP35P, предоставленная И.Л. Деркач, содержит последовательность гена SUP35 Pichia methanolica [Derkatch et al., 2000].

Плазмида pCUP1-RNQ1-CFP(LEU2) любезно предоставлена С.П. Задорским (СПбФ ИОГен РАН, Россия). Плазмида pNR-ABF1, несущая полноразмерный SUP35 с делецией сайта связывания транскрипционного фактора Abf1p в промоторе, любезно предоставлена Н.А. Рябинковой. Плазмиды YEpHO [Jensen et al., 1983] и pRS315 [Sikorski and Hieter, 1989] были описана ранее.

Мультикопийная плазмида pLH105 содержит ген HSP104 под контролем промотора GPD [Vogel et al., 1995]. Плазмиды pRS315-SUP35MC и pRS316любезно предоставленные проф. Ю.О. Черновым, содержат SUP35MC, последовательность, кодирующую домены М и С белка Sup35 под контролем собственного промотора. После промотора перед последовательностью SUP35MC встроен полилинкер, содержащий сайты для эндонуклеаз рестрикции BamHI и SacI [Saifitdinova et al., 2010]. Плазмида pYCH-U2, любезно предоставленная И.Л.

Деркач, содержит ген SUP35 под контролем собственного промотора [Derkatch et al., 1997]. Плазмиды pSP-YFP и pSP-CFP любезно предоставлены С.П.Задорским.

Плазмида p426GPD–SWI1YFP, любезно предоставленная проф. Г.А. Журавлвой, была описана ранее [Du and Li, 2014]. Центромерная плазмида pID129, содержащая ген RNQ1 была описана ранее [Kadnar et al., 2010].

Плазмиды pDB691 (UGAC) и pDB690 (CGAC) любезно предоставлены М.Д.

Тер-Аванесяном. Эти плазмиды несут тандемно расположенные гены, кодирующие люциферазы коралла Renilla и жука-светлячка, разделенные стопкодоном UGA (pDB691) или значащим кодоном CGA (pDB690) [Keeling et al., 2006; Kallmeyer et al., 2006].

Далее описаны плазмиды, сконструированные в ходе данной работы.

Плазмида pmCUP1-SUP35MC была сконструирована следующим образом – фрагмент XhoI-BamHI, содержащий последовательность промотора CUP1 из плазмиды pmCUP1 [Serio, et al. 1999] был встроен в вектор pRS425 [Labbe-Bois 1990]. На следующем этапе последовательность SUP35MC, фланкированная сайтами рестрикции BamHI-SacI, была встроена вслед за промотором CUP1 [Saifitdinova et al., 2010].

Плазмида pU-A-SUP35MC [Цапонина и др., 2005] были сконструированы как описано ниже. Последовательность, кодирующая пептид А (40 аминокислот) человека, была получена из тотальной РНК мозга абортуса при помощи метода RT-PCR (обратной полимеразной цепной реакции). Синтез кДНК проводился с помощью набора реактивов и согласно протоколу фирмы “Fermentas”. Праймеры содержат сайты рестрикции и стартовый кодон АТГ и BamHI SacI, последовательности комплементарные 5’ и 3’ концам ДНК, кодирующей пептид А (таблица 6).

–  –  –

Для получения плазмиды pL-A-SUP35MC, содержащей маркрный ген LEU2, последовательность PCUP1-A-SUP35MC из плазмиды pU-A-SUP35MC, фланкированная сайтами рестрикции XhoI-SacI, была встроена в вектор pFL36 (Bonneaud, et al. 1991).

PCUP1-GFP(URA3) – многокопийная плазмида, созданная на основе вектора pFL44S, содержит последовательность гена sGFP под контролем промотора CUP1, гены – ampR, URA3, бактериальный и дрожжевой ориджины репликации.

Плазмида получена путм интеграции фрагмента XhoI-SacI из плазмиды pRS316CG, несущего последовательность гена GFP под контролем промотора CUP1, в вектор pFL44S, гидролизованный эндонуклеазами рестрикции XhoI и SacI.

PGPD-GFP(URA3) [Рубель и др., 2008] – многокопийная плазмида, созданная на базе вектора pFL44S, содержит последовательность гена sGFP под контролем промотора GPD, гены – ampR, URA3, бактериальный и дрожжевой ориджины репликации. Плазмида pGPD-GFP(LEU2) была получена за счт инсерции фрагмента плазмиды PGPD-GFP(URA3), содержащего последовательность PGPDGFP (SalI-SacI) в плазмиду pRS425 гидролизованную рестриктазами SalI и SacI.

–  –  –

Плазмиды pGPD-PrP23-231-CFP(LEU2), pGPD-PrP28-231-CFP(LEU2) pGPDи были сконструированы PrP90-231-CFP(LEU2) pGPD-PrP110-231-CFP(LEU2) следующим образом – последовательности, кодирующие фрагменты белка PrP мыши PrP23-231, PrP28-231, PrP90-231 и PrP110-231, фланкированные сайтами рестрикции BamHI и SacII, были интегрированы в вектор pGPD-CFP(LEU2) по тем же сайтам, расположенным вслед за промотором GPD. Таким же образом, на базе вектора pGPD- YFP(URA3) была получена плазмида pGPD-PrP23-231-YFP(URA3). Цифрами в названии плазмид обозначены номера первой и последней аминокислоты в составе соответствующих фрагментов белка PrP мыши. Последовательности использованных праймеров приведены в таблице 6.

Плазмиды pGPD-PrP23-231-GFP(URA3), PGPD- PrP90-231-GFP(URA3) и pGPDA-GFP(URA3) были получены за счт интеграции ПЦР фрагментов PrP23-231 PrP90-231, и A (40 аминокислот), фланкированных сайтами рестрикции BamHI и SacII в вектор pGPD-GFP(URA3).

–  –  –

pU-VTS1 – мультикопийная плазмида содержит последовательность, кодирующую ген VTS1 под контролем индуцибельного промотора CUP1.

Последовательность VTS1 была амплифицирована из геномной ДНК штамма 2-1D931 и интегрирована в плазмиду PCUP1-GFP(URA3), гидролизованную по сайтам рестрикции Последовательность праймеров BamHI and SacII.

FVTS1BamH1 и RVTS1Sac2 приведена в таблице 6.

PMIT1-MIT1-GFP – центромерная плазмида, содержит гены – ampR, URA3, бактериальный и дрожжевой ориджины репликации. Последовательность гена MIT1, включая промоторную область, была амплифицирована с помощью праймеров MIT1F и MIT1R (таблица 6). В качестве матрицы использовалась плазмида YGPM21o12 геномной дрожжевой библиотеки. Амплифицированный фрагмент был встроен в плазмиду pRS316CG, гидролизованную эндонуклеазами рестрикции ClaI и BamHI.

PGPD-GAS1-YFP – мультикопийная плазмида, содержит гены – ampR, URA3, бактериальный и дрожжевой ориджины репликации. Плазмида была получена путм замены последовательности PrP23-231 в плазмиде pGPD-PrP23-231-YFP(URA3) на последовательность GAS1, амплифицированную с помощью праймеров FGAS1 и RGAS1 (таблица 6) и фланкированную сайтами рестрикции ВамHI и SacI. В качестве матрицы для амплификации гена GAS1 использовали геномную ДНК, выделенную из штамма BY4742.

Для проведения геномных скринингов в работе использовали адресную дрожжевую геномную библиотеку YSC4613 “Open Biosystems” (ЕС). Библиотека включает 1588 клонов E. coli, несущих челночный многокопийный вектор pGP564 с уникальными фрагментами генома S. cerevisiae, клонированными в вектор по сайтам гидролиза BamHI. Вставки содержат несколько открытых рамок считывания. Каждый клон содержит одну плазмиду с несколькими генами S.

cerevisiae с известной нуклеотидной последовательностью. Вектор pGP564 маркирован геном устойчивости к антибиотику канамицину для селекции в бактериях и геном прототрофности по лейцину для селекции в дрожжах.

Таблица 5 Плазмиды, использованные в работе

–  –  –

Таблица 6. Праймеры, использованные для плазмидного конструирования Праймер Последовательность 5'-3'

FPrP23 CCCGGATCCTATATGTCTAAAAAGCGGCCAAAGCCTGGAGG

GT

FPrP28 GACTTTGGATCCTATATGCCTGGAGGGTGGAACAC

FPrP90 GTTCATGGATCCTATATGTCTCAAGGAGGGGGTACCCAT

FPrP110 GAATAGGATCCACAATGCATATGGCAGGGGCTGCG

FA GGGTCCACGGATCCTATATGTCTGATGCAGAATTCCGACAT

RA GTTATAAAGGATCCGACAACACCGCCCACCAT

RPrP231 CATCCGCGGGCTGGATCTTCTCCCGTCGTAATAGGCCT

FA GGGTCCACGGATCCTATATGTCTGATGCAGAATTCCGACAT

RA GTTATAAAGGATCCGACAACACCGCCCACCAT

FVTS1 GAGCGGATCCATGAAACATCCGTATGAGGAATTCC

RVTS1 CATCCCGCGGTGCAACGTCAAGACAATCAAC

FMIT1 CCGATCGATGCTTCGATTGGTAACAGTG

RMIT1 CGCCCGCGGTTGTGTAGTAGTTGAAGTGTT

FGAS1 GACTTAGGATCCTATATGTTGTTTAAATCCCTTTCA

RGAS1 CAAATACCGCGGTCCGGAACCCAAATCAACA

86

Методы дрожжевой генетики 2.3.

В работе применяли стандартные генетические методы, используемые при работе с дрожжами: метод рассева истощающим штрихом, метод селективных сред для анализа ауксотрофности штаммов, метод отпечатков, методы тетрадного анализа и случайной выборки аскоспор [Инге-Вечтомов, 1971, Захаров и др., 1984;

Rose et al., 1990]. Тип спаривания исследуемых штаммов определяли по способности образовывать гибриды с тестерными штаммами. Для элиминации прионоподобных детерминантов штаммы пассировали 3 раза на среде YAPD, содержащей хлорид гуанидина (GuHCl). Затем дрожжи клонировали на среде YAPD и перепечатывали на среду без аденина [Tuite et al., 1981]. Отбирали клоны, утратившие способность к росту на среде без аденина. Супрессию мутаций ade1-14 (UGA) trp1-289 (UAG) оценивали по способности к росту штаммов на селективных средах без аденина и без триптофана, соответственно.

Потерю плазмид, содержащих маркер URA3, производили на селективной среде с добавлением 5-FOA [Kaiser et al., 1994]. Селекцию клонов, устойчивых к генетицину, проводили путем трехкратного пассирования на твердой среде YAPD с добавлением G418 [Sambrook et al. 1989]. Анализ роста штаммов на среде MG и MGly проводили путем трех последовательных перепечатываний штаммов с инкубацией после каждого перепечатывания в течение суток при 300С. Тетрадный анализ проводили под микроскопом производства “Carl Zeiss” (Германия), используя микроманипулятор Ergaval Series 10 “Carl Zeiss” (Германия).

Для изучения возможности переноса цитоплазматических детерминантов путм цитодукции использовали систему отбора цитодуктантов, основанную на том, что донором цитоплазмы является штамм [rho+], а реципиентом – штамм [rho0] (полная делеция митохондриальной ДНК), маркированный рецессивной (cyhr) мутацией устойчивости к циклогексимиду и мутацией kar1-1, препятствующей кариогамии.

Трансформацию дрожжей плазмидной ДНК проводили по стандартной методике с использованием ацетата лития [Rose et al., 1990]. Для повышения эффективности трансформации в каждую пробу добавляли по 6 мкг ДНКносителя (обработанной ультразвуком ДНК спермы лосося, “Fermentas” (Литва)).

Получение компетентных клеток E. coli и трансформацию бактерий проводили по стандартной методике [Inoue et al., 1990].

Белковую трансформацию для передачи прионных факторов из клеток одного штамма в другой проводили согласно методике, описанной ранее [Tanaka and Weissman 2006; Patel and Liebman 2007]. Для отбора трансформантов, получивших прион [PIN+], сферопласты [pin-] трансформировали белковым лизатом из штамма [pin-], а также плазмидой pmCUPNMsGFP, продуцирующей химерный белок Sup35NM-GFP. Отбирали трансформантов, в которых белок формировал цитологически детектируемые агрегаты, что Sup35NM-GFP характерно для штаммов [PIN+]. В остальных случаях о передаче прионов судили по фенотипическим изменениям исследуемых штаммов и по данным биохимического анализа, позволяющего выявлять прионные агрегаты.

Полимеразная цепная реакция в реальном времени 2.4.

Тотальную РНК выделяли из исследуемых штаммов дрожжей с использованием реагента “Trizol” (“Invitrogene”, США) по протоколу производителя. Для исключения возможности контаминации ДНК, выделенную тотальную РНК обрабатывали ДНК-зой I (“Fermentas”). Реакцию обратной транскрипции проводили с использованием набора Super Script III (“Invitrogene”, США) согласно протоколу производителя. Полимеразную цепную реакцию в реальном времени (ПЦРРВ) проводили в амплификаторе АНК-16 (ИАнП РАН).

Последовательности праймеров и зондов TaqMan приведены в таблице 7. Анализ независимо выделенных проб тотальной мРНК проводили при помощи метода 2 Ct, предложенного Ливаком и Шмитгеном [Livak and Schmittgen, 2001]. В данном методе используется параметр Ct, который показывает различия в интенсивности сигналов между исследуемым и контрольным (ACT1) генами.

Затем, рассчитывают параметр Ct, который равен разности между параметрами Ct в эксперименте и контроле. В заключение рассчитывается 2-C(t). Это значение соответствует разнице в количестве мРНК между экспериментальной и контрольной пробой. Результаты представлены с планками погрешностей, соответствующими стандартному отклонению. Достоверность отличий оценивали при помощи непараметрического критерия Манна-Уитни с использованием программного обеспечения “Statistica” версии 6.0 (“StatSoft”).

Таблица 7. Праймеры и зонды для ПЦРРВ Название Последовательность 5’-3’ ACT1probe (FAM*)CGTGCTGTCTTCCCATCTATCGTCGGT(BHQ1**)

ACT1f TAACGGTTCTGGTATGTGTAAAG

ACT1r TCATCACCAACGTAGGAGTCTT

SUP35probeF (R6G***)CACCCTACTGATGCCTAACAAAACCGCT(BHQ1)

RTSUP35R GTTTAACTTGCTCACCACACATA

RTSUP35F TATTGCCGCTAAGATGAAGGAT

Примечания:

* (FAM) – флуорофор FAM.

** (BHQ1) – гаситель флуоресценции BHQ1.

*** (R6G) – флуорофор R6G.

–  –  –

Эффективность терминации трансляции оценивали с помощью метода бицистронной люминесценции [по: Valouev et al., 2009]. Были использованы плазмиды pDB691 (UGAC), pDB690 (CGAC), pDB720 (UAGC) и pDB721 (CAGC) любезно предоставленные М.Д. Тер-Аванесяном. Эти плазмиды несут тандемно 89 расположенные гены, кодирующие люциферазы коралла Renilla и жукасветлячка, разделенные стоп-кодоном UGA (pDB691), UAG (pDB720) или значащим кодоном CGA (pDB690) и CAG (pDB721) (таблица 5) [Keeling et al.

2006; Kallmeyer et al. 2006]. Измерения проводили в люминометре с использованием набора реактивов Dual Reporter Assay (“Promega”, США).

Эффективность считывания стоп-кодона как значащего вычисляли как частное показаний активности люциферазы и люциферазы светлячка, Renilla экспрессируемых с плазмиды, содержащей стоп-кодон, умноженное на частное показаний активности люциферазы светлячка и люциферазы Renilla, экспрессируемых с плазмиды не содержащей стоп-кодон, и умноженное на 100 для выражения значения в процентах. Достоверность отличия от контроля проверяли непараметрическим критерием Манна-Уитни с использованием программного обеспечения “Statistica” версии 6.0 (“StatSoft”).

Флуоресцентная микроскопия 2.6.

Анализ колокализации флуоресцентных белков, а также эксперименты по измерению эффективности проводили при помощи лазерного FRET, сканирующего конфокального микроскопа Leica TCS SP5 «Leica Microsystems GmBH» (Германия) и программного обеспечения «LAS AF Application Wizard Version 1.7.0» «Leica Microsystems GmBH» (Германия), на базе центра коллективного пользования СПбГУ «Хромас». Для детекции CFP или CFP содержащих белков, использовали аргоновый лазер с длиной волны 458нм, сигнал детектировали в пределах 461-510 нм, для детекции YFP или YFP содержащих белков, использовали аргоновый лазер с длиной волны 514 нм, сигнал детектировали в пределах 518-580 нм.

Небольшое количество дрожжевых клеток, после одного – двух дней инкубации на тврдой или жидкой селективной среде, растворяли в 7 мкл стерильной воды и равномерно распределяли по поверхности стекла. После высыхания препарат заключали в раствор «VECTASHIELD Mounting Media»

фирмы «Vector Laboratories Inc.» (США) и накрывали покровным стеклом.

Излишки раствора удаляли с помощью фильтровальной бумаги, после чего края покровного стекла заклеивали лаком для ногтей.

Для определения частот клеток с видимыми агрегатами белков, слитых с последовательностями GFP, YFP или CFP, микроскоп переводили в режим фазового контраста и случайным образом выбирали поле зрения. Клетки фотографировали, используя видеокамеру и систему компьютерного анализа изображения. Далее, микроскоп переводили в режим детекции флуорохромов GFP, YFP или CFP и фотографировали то же поле зрения. Подсчт общего количества клеток в выбранных полях зрения, а также подсчт клеток, содержащих флуоресцентные агрегаты, проводили, используя файлы компьютерных изображений.

Для определения частот колокализации белков, слитых с флуорохромами YFP и CFP, подсчитывали количество клеток, содержащих оба флуорохрома, а также количество клеток, в которых локализация агрегатов, маркированных YFP и CFP совпадала. Частоты колокализации определяли как отношение количества клеток с совпадающей локализацией агрегатов, маркированных YFP и CFP, к количеству клеток, содержащих оба флуорохрома.

Дрожжевые вакуоли окрашивали с помощью красителя FM4-64 (SynaptoRed) “Invitrogen” (США) согласно протоколу [Meriin et al., 2002]. Окраску ядерной и митохондриальной ДНК проводили, используя краситель DAPI “Invitrogen” (США). Окраску эндосом проводили с помощью красителя LisoInvitrogen” (США) согласно протоколу и рекомендациям tracker Blue производителя.

Эндоплазматическую сеть (ЭПС) и аппарат Гольджи (АГ) окрашивали с помощью красителя ER-Tracker™ Red “Invitrogen” (США) согласно протоколу и рекомендациям производителя. Для детекции флуоресценции DAPI и эндосом, окрашенных Liso-tracker Blue, использовали Ar UV лазер 405 и 91 детектировали сигнал в пределах 425-475 нм. Для детекция вакуолярных мембран, окрашенных SynaptoRed, использовали лазеры DPSS 561, HeNe 633 и 594, сигнал детектировали в пределах 615-758 нм (максимум флуоресценции 680 нм).

Анализ физического взаимодействия белков A-YFP и различных вариантов PrP-CFP методом AB FRET (Acceptor photobleaching fluorescence resonance energy transfer) проводили, используя метод фотовыжигания акцептора [по: Roszik et al., Эффективность передачи энергии и, соответственно, степень 2013].

взаимодействия белков, оценивали при сравнении интенсивности флуоресценции донора в присутствии и в отсутствии акцептора.

Показатели FRET оценивали в зоне клетки, содержащей цитологически детектируемый агрегат PrP-CFP, который колокализуется A-YFP. В области интереса (ROI) замеряли флуоресценцию донора (CFP) до и после фотовыжигания акцептора. Для фотовыжигания акцептора использовали аргоновый лазер с длиной волны 514 нм при максимальной интенсивности светового потока. Время выжигания составляло 10 сек. Эффективность FRET (FRETeff) рассчитывали по формуле: FRETeff=[DpostDpre]/Dpost.

Dpost – это флуоресценция донора после фотовыжигания акцептора, Dpre – флуоресценция донора до фотовыжигания акцептора.

Иммунохимический анализ белков.

2.7.

2.7.1. Выделение белка из дрожжей Выделение суммарного белка из дрожжей проводили методом разрушения клеток стеклянными шариками. Дрожжевые культуры выращивали сутки на жидкой среде YAPD, или на среде MD с необходимыми добавками. Клетки переносили в центрифужные пробирки “Beckman” (45 мл). Добавляли циклогексемид, до конечной концентрации 200 мкг/мл, и качали на шейкере в течение 20 минут. После этого клетки осаждали в центрифуге “Beckman J2-21” (5 мин, 3000 об/мин) при +4° C. Супернатант сливали, а осадок ресуспендировали в 1 мл циклогексемида (200 мкг/мл) и переносили в микропробирку (1,5 мл). После этого клетки снова осаждали в центрифуге “Jouan CR3i” (Франция) (5 мин, 3000 об/мин) при +4° C. Супернатант сливали, а осадок ресуспендировали в 0,5 мл ледяного лизирующего буфера (50 мM Tris-HCI pH 7,5; 0,1 мM ЭДТА; 5 мM MgCI2; 0,1 мM DTT; 100 мкг/мл РНКазаA; 10 мM KCI; 100 мкг/мл циклогексемид;

2 мM PMSF; 1 мM бензамидин; 2 мкг/мл пепстатин A; 10 мкг/мл; леупептин) или буфера TNE (150 мM NaCl, 50мM Tris-HCl, pH7,5; 2мM ЭДТА; 2 мM PMSF; 1 мM бензамидин; 2 мкг/мл пепстатин A; 10 мкг/мл леупептин). Полученную суспензию центрифугировали (5 мин, 3000 об/мин) при 4С, супернатант сливали, а полученный осадок ресуспендировали в равном объме лизирующего или TNE буфера. Далее, для разрушения клеток к осадку добавляли равный объм отмытых в азотной кислоте стеклянных шариков (glass beads) “Sigma” (США) и проводили 9 циклов дизрупции на шейкере по 20 сек, с перерывами не менее 1 мин на льду.

Клеточный лизат переносили в пробирки типа эппендорф, дважды отмыв стеклянные шарики 150 мкл лизирующего буфера. Полученный клеточный лизат центрифугировали (5 мин, 3000 об/мин) при 4С, супернатант делили на 2 части, одну из которых использовали для анализа, а вторую – для оценки концентрации белка.

Для денатурации белков перед нанесением их на гель или хранением (при С) к пробам добавляли 1/3 объма 4-х кратного буфера для образцов (100 мM Tris-HCI pH 6,8, 20% 2-меркаптоэтанол, 8% SDS, 0,2% бромфеноловый синий, 40% глицерин), после чего инкубировали 10 минут при 100С.

Перед анализом белков с помощью метода полуденатурирующего электрофореза в агарозном геле к пробам добавляли 1/3 объма 4-х кратного буфера для образцов 2 (50 мM Tris-HCI pH 6,8, 4% SDS, 0,2% бромфеноловый синий, 20% глицерин) и инкубировали 7 минут при комнатной температуре.

2.7.2. Дифференциальное центрифугирование

Дифференциальное центрифугирование дрожжевых клеточных лизатов [Patino et al., 1996; Chernoff et al., 2002] проводили при 12000 g 30 мин при 4С, или в случае с анализом агрегатов Swi1-YFP при 75000 g 50 мин при 4С.

Надосадочную фракцию переносили в новую пробирку, а к осадку добавляли равный объм лизирующего буфера.

2.7.3. Анализ устойчивости белков к действию протеиназы К

Для анализа устойчивости белков к действию протеиназы К (ПК) из дрожжей выделяли суммарный белок, используя TNE буфер (см. выше) без добавления ингибиторов протеаз, или, чтобы уменьшить активность эндогенных дрожжевых протеаз, добавляли ингибиторы, которые не влияют на работу ПК (0,5х хемостатин и пепстатин А) [Ma and Lindquist, 1999]. Образцы с добавлением ПК в различной концентрации, а также, контрольный образец без ПК, инкубировали 30 минут при 37oC. Для ингибирования ПК в каждую пробу добавляли PMSF до конечной концентрации 0,2 мМ. Далее, в пробы добавляли 1/3 объма 4х буфера для образцов 1 и инкубировали 10 минут при 100С, после чего пробы наносили на гель или хранили при -70С.

2.7.4. Белковый электрофорез и «Вестерн-блот» гибридизация

–  –  –

(Великобритания). Для ориентировочного определения размера белков использовали маркер молекулярного веса “RainBow” “Amersham” (Великобритания).

Оценку устойчивости агрегатов белков к обработке 3% саркозинатом натрия или 1% SDS проводили с помощью метода полуденатурирующего белкового электрофореза в агарозном геле [Kryndushkin et al., 2003] с модификациями [Bagriantsev et al., 2006]. Белковый лизат инкубировали 10 минут с 3% саркозинатом натрия или 1% SDS при комнатной температуре.

Полуденатурирующий белковый электрофорез проводили как описано ранее [Kushnirov et al., 2006] в 1,5% агарозном геле в буфере Лэмли [Laemmli, 1970], содержащем 0,1% SDS при напряжнности электрического поля 5 В/см, в течение 3,5-4 часов. Электроперенос белков с агарозного геля на мембрану PVDF HybondP мембрану проводили с помощью модуля для переноса “Mini-PROTEAN 3 Cell” “Bio-Rad” (Италия) в буфере Лэмли, содержащем 0,1% SDS при напряженности электрического поля 25V, в течение ночи.

Выравнивание количества суммарного белка для полуденатурирующего электрофореза проводили согласно протоколу, предложенному Брэдфордом (Bradford, 1976), и набору реактивов компании “BioRad” (США).

Иммунохимическую реакцию проводили с использованием первичных антител, представленных в таблице 8, и вторичных моноклональных антител к иммуноглобулинам мыши или к иммуноглобулинам кролика, конъюгированными с пероксидазой хрена фирмы “Amersham” (Великобритания). Вторичные антитела детектировали с использованием наборов реактивов “ESL” и “ESL-advanced” фирмы “Amersham” (Великобритания), согласно прилагающейся инструкции.

Таблица 8. Описание антител, использованных в работе

–  –  –

Anti-Sup35C поликлональные Chabelskaya et 1:2000 кроличьи антитела против домена С al., 2004 белка Sup35 S. cerevisiae SE-45-2 - поликлональные кроличьи Kiktev et al., 2009 1:5000 антитела против Sup45 S. cerevisiae

–  –  –

Протеомный метод выявления и идентификации амилоидов 2.8.

Общая схема протеомного метода выявления и идентификации амилоидов, включающая два варианта разделения и идентификации белков приведена на рисунке 9.

Рисунок 9. Схема, отражающая два варианта метода протеомного скрининга и идентификации белков, формирующих детергент-устойчивые агрегаты.

А Выделение фракции белковых агрегатов, устойчивых к обработке 1% SDS или 3% саркозинатом натрия. Б – разделение белков методом двумерного электофореза и и их идентификация с помощью масс-спектрометрии. В – разделение и идентификация белков методом HPLC-MALDI.

2.8.1. Выделение фракции белковых агрегатов, устойчивых к обработке ионными детергентами Выделение фракции белковых агрегатов, устойчивых к обработке ионными детергентами проводили в соответствии методикой описанной ранее [Kushnorov et al., 2006], и нашими существенными модификациями [Nizhnikov et al., 2014].

1. Культуру дрожжей растили сутки в 250 мл среды YPD.

2. Клетки осаждали при 2500g, 10 мин., 4оС.

3. Осадок (примерно 4 – 5 грамм клеток) суспендировали в 5мл буфера (50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 10mM EDTA, 10Mm PMSF, 10mM DTT).

4. Добавляли к суспензии равный объм стеклянных бус (0.4 mm GLC, MerckBDH) и ставили на лд. Клетки разрушали на дезинтеграторе “Fisher Scientific” шесть циклов по одной минуте с перерывом в одну минуту между каждым циколом для охлаждения проб на льду.

–  –  –

6. Инкубировали белковый лизат в течение 30 мин. при 30°С.

7. Белковый лизат наслаивали на 2мл. сахарозной подушки (25% сахароза в буфере TBS).

8. Пробы ультрацентрифугировали 2ч., 223 600g при 4oC в роторе Ti75.



Pages:     | 1 | 2 || 4 | 5 |   ...   | 7 |
 

Похожие работы:

«Цвиркун Ольга Валентиновна ЭПИДЕМИЧЕСКИЙ ПРОЦЕСС КОРИ В РАЗЛИЧНЫЕ ПЕРИОДЫ ВАКЦИНОПРОФИЛАКТИКИ. 14.02.02 – эпидемиология ДИССЕРТАЦИЯ на соискание ученой степени доктора медицинских наук Научный консультант: заслуженный деятель науки РФ, лауреат Государственной премии СССР профессор, доктор медицинских наук Ющенко Галина Васильевна Москва – 20 Содержание...»

«Доронин Максим Игоревич ЭКСПРЕСС-МЕТОДЫ ВЫЯВЛЕНИЯ ВИРУСА ИНФЕКЦИОННОГО НЕКРОЗА ГЕМОПОЭТИЧЕСКОЙ ТКАНИ ЛОСОСЕВЫХ РЫБ 03.02.02 «Вирусология» Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, Мудрак Наталья Станиславовна Владимир 2015 ОГЛАВЛЕНИЕ 1 ВВЕДЕНИЕ 2 ОБЗОР ЛИТЕРАТУРЫ 2.1 Характеристика возбудителя инфекционного...»

«Радугина Елена Александровна РЕГУЛЯЦИЯ МОРФОГЕНЕЗА РЕГЕНЕРИРУЮЩЕГО ХВОСТА ТРИТОНА В НОРМЕ И В УСЛОВИЯХ ИЗМЕНЕННОЙ ГРАВИТАЦИОННОЙ НАГРУЗКИ 03.03.05 – биология развития, эмбриология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: Доктор биологических наук Э.Н. Григорян Москва – 2015 Оглавление Введение Обзор литературы 1 Регенерация...»

«Петренко Дмитрий Владимирович Влияние производства фосфорных удобрений на содержание стронция в ландшафтах Специальность 03.02.08 экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, профессор Белюченко Иван Степанович Москва – 2014 г. Содержание Введение Глава 1.Состояние изученности вопроса и цель работы 1.1 Экологическая...»

«Моторыкина Татьяна Николаевна ЛАПЧАТКИ (РОД POTENTILLA L., ROSACEAE) ФЛОРЫ ПРИАМУРЬЯ И ПРИМОРЬЯ 03.02.01 – Ботаника Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, старший научный сотрудник Н.С. Пробатова Хабаровск Содержание Введение... Глава 1. Природные...»

«НГУЕН ВУ ХОАНГ ФЫОНГ ОЦЕНКА ЭКОЛОГИЧЕСКОЙ СИТУАЦИИ КРУПНЫХ ГОРОДОВ В СОЦИАЛИСТИЧЕСКОЙ РЕСПУБЛИКЕ ВЬЕТНАМ Специальность: 03.02.08экология (биология) Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель: доктор биологических наук, профессор Чернышов В.И. Москва ОГЛАВЛЕНИЕ ГЛАВА 1. ОБЩАЯ ХАРАКТЕРИСТИКА...»

«КЛЁНИНА АНАСТАСИЯ АЛЕКСАНДРОВНА УЖОВЫЕ ЗМЕИ (COLUBRIDAE) ВОЛЖСКОГО БАССЕЙНА: МОРФОЛОГИЯ, ПИТАНИЕ, РАЗМНОЖЕНИЕ Специальность 03.02.08 – экология (биология) (биологические науки) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: кандидат биологических наук, доцент Бакиев А.Г. Тольятти – 2015 СОДЕРЖАНИЕ ВВЕДЕНИЕ ГЛАВА 1. К...»

«АУЖАНОВА АСАРГУЛЬ ДЮСЕМБАЕВНА ОЦЕНКА ДЕЙСТВИЯ АБИОТИЧЕСКИХ ФАКТОРОВ И БИОПРЕПАРАТА РИЗОАГРИН НА МИКРОБИОЛОГИЧЕСКУЮ АКТИВНОСТЬ ПОЧВЫ, АДАПТИВНОСТЬ И ПРОДУКТИВНОСТЬ ЯРОВОЙ МЯГКОЙ ПШЕНИЦЫ 03.02.08 – Экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор...»

«БОЛОТОВ ВЛАДИМИР ПЕТРОВИЧ ОЦЕНКА СОДЕРЖАНИЯ И МИГРАЦИЯ ТЯЖЕЛЫХ МЕТАЛЛОВ В ЭКОСИСТЕМАХ ВОЛГОГРАДСКОГО ВОДОХРАНИЛИЩА Специальность: 03.02.08. Экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук,...»

«Головань Екатерина Викторовна Ресурсы декоративных растений для озеленения внутриквартальных территорий (на примере г. Владивостока) 03.02.14 – биологические ресурсы Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: д.б.н., доцент О.В. Храпко Владивосток — Оглавление Введение Глава 1. Современные подходы...»

«Иртегова Елена Юрьевна РОЛЬ ДИСФУНКЦИИ СОСУДИСТОГО ЭНДОТЕЛИЯ И РЕГИОНАРНОГО ГЛАЗНОГО КРОВОТОКА В РАЗВИТИИ ГЛАУКОМНОЙ ОПТИЧЕСКОЙ НЕЙРОПАТИИ 14.01.07 – глазные болезни ДИССЕРТАЦИЯ на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор медицинских наук, профессор...»

«БОЛГОВА Светлана Борисовна РЫБНЫЕ КОЛЛАГЕНЫ: ПОЛУЧЕНИЕ, СВОЙСТВА И ПРИМЕНЕНИЕ Специальность: 05.18.07 Биотехнология пищевых продуктов и биологических активных веществ Диссертация на соискание ученой степени кандидата технических наук Научный руководитель: Заслуженный деятель науки РФ, доктор технических наук, профессор Антипова...»

«СИМАНИВ ТАРАС ОЛЕГОВИЧ ОПТИКОМИЕЛИТ И ОПТИКОМИЕЛИТ-АССОЦИИРОВАННЫЕ СИНДРОМЫ ПРИ ДЕМИЕЛИНИЗИРУЮЩИХ ЗАБОЛЕВАНИЯХ 14.01.11 – Нервные болезни ДИССЕРТАЦИЯ на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор медицинских наук М. Н. Захарова Москва – 2015 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ Глава 1. Обзор литературы Оптиконевромиелит Аквапорины и их биологическая функция 13 Патогенез...»

«ТУРТУЕВА ТАТЬЯНА АНАТОЛЬЕВНА РАЗРАБОТКА СБОРА НЕЙРОПРОТЕКТИВНОГО И ЭКСТРАКТА СУХОГО НА ЕГО ОСНОВЕ 14.04.02 фармацевтическая химия, фармакогнозия ДИССЕРТАЦИЯ на соискание ученой степени кандидата фармацевтических наук Научный руководитель: доктор фармацевтических наук, профессор НИКОЛАЕВА ГАЛИНА ГРИГОРЬЕВНА Улан-Удэ – 2015 ОГЛАВЛЕНИЕ...»

«КОЖАРСКАЯ ГАЛИНА ВАСИЛЬЕВНА КЛИНИЧЕСКОЕ ЗНАЧЕНИЕ МАРКЕРОВ КОСТНОГО МЕТАБОЛИЗМА У БОЛЬНЫХ РАКОМ МОЛОЧНОЙ ЖЕЛЕЗЫ 14.01.12 онкология Диссертация на соискание ученой степени кандидата медицинских наук Научные руководители: доктор биологических наук, Любимова Н.В. доктор медицинских наук, Портной С.М. Москва, 2015 г....»

«Шинкаренко Андрей Семенович Формирование безопасного и здорового образа жизни школьников на современном этапе развития общества Специальность 13.00.01– общая педагогика, история педагогики и образования Диссертация на соискание ученой степени кандидата педагогических наук Научные...»

«Труш Роман Викторович ФАРМАКО-ТОКСИКОЛОГИЧЕСКОЕ ИССЛЕДОВАНИЕ СКАЙ-ФОРСА И ЕГО ЭФФЕКТИВНОСТЬ ПРИ КОЛИБАКТЕРИОЗЕ ЦЫПЛЯТ-БРОЙЛЕРОВ 06.02.03 – ветеринарная фармакология с токсикологией Диссертация на соискание ученой степени кандидата ветеринарных наук Научный руководитель Горшков Григорий Иванович заслуженный деятель науки РФ, доктор биологических наук, профессор Белгород – п. Майский 2015 г. СОДЕРЖАНИЕ...»

«АБДУЛЛАЕВ Ренат Абдуллаевич ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ МЕСТНЫХ ФОРМ ЯЧМЕНЯ ИЗ ДАГЕСТАНА ПО АДАПТИВНО ВАЖНЫМ ПРИЗНАКАМ Шифр и наименование специальности 03.02.07 – генетика 06.01.05 – селекция и семеноводство сельскохозяйственных растений ДИССЕРТАЦИЯ на соискание учёной степени кандидата...»

«Петухов Илья Николаевич РОЛЬ МАССОВЫХ ВЕТРОВАЛОВ В ФОРМИРОВАНИИ ЛЕСНОГО ПОКРОВА В ПОДЗОНЕ ЮЖНОЙ ТАЙГИ (КОСТРОМСКАЯ ОБЛАСТЬ) Специальность: 03.02.08 экология (биологические науки) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, профессор В.В. Шутов...»

«Брит Владислав Иванович «Эффективность методов вакцинации против ньюкаслской болезни в промышленном птицеводстве» Специальность: 06.02.02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология ДИССЕРТАЦИЯ на соискание ученой степени кандидат ветеринарных наук Научный руководитель:...»







 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.