WWW.KONF.X-PDF.RU
- , ,
 


Pages:     | 1 |   ...   | 3 | 4 ||

5N ...

-- [ 5 ] --

3. Brown LH., Done S.H., Spencer Y.I, Cooley W.A., Harris P.A., Alexander D.J. Pathogenicity of swine influenza H1N1 virus antigenically distinguishable from classical and European strains.

// Vet. Rec. - 1993. - Vol.132. - P.598-602.

4. Brown, I.H., Harris P.A., McCauley J.W., Alexander D.J. Multiple genetic reassortment of avian and human influenza A viruses in European pigs, resulting in emergence of an H1N2 virus of novel genotype. // J. Gen. Virol. - 1998. - Vol.79. - P.2947-2955.

5. Capua I, Alexander D.J. Avian influenza and human health. // Acta Trop. - 2002 - Vol.83. 1.

- P.1-6. Review.

6. Castrucci M.R., Donatelli I., Sidoli L, Barigazzi G., Kawaoka Y., Webster R.G. Genetic reassortment between avian and human influenza viruses in Italian pigs. // Virology. - 1993. Vol.l93. - P.503-506.

7. Cauthen A.N., Swayne D.E., Schultz-Cherry S., Perdue M.L., Suarez D.L. Continued circulation in China of highly pathogenic avian influenza viruses encoding the hemagglutinin gene associated with the 1997 H5N1 outbreak in poultry and humans. // J.Virol. - 2000. - Vol.74.

- N 14. - P.6592-6599.

8. Li, Wang J., Smith G.J.D. Genesis of a highly pathogenic and potentially pandemic H5N1 influenza virus in eastern Asia // Nature. - 2004. - Vol.430. - P.209-213.

9. Payungporn S, Phakdeewirot P, Chutinimitkul S, Theamboonlers A, Keawcharoen J, Oraveerakul K, Amonsin A, Poovorawan Y. Single-step multiplex reverse transcriptionpolymerase chain reaction (RT-PCR) for influenza A virus subtype H5N1 detection // Viral Immunol. 2004; 17 (4): 588-93.

10. Recommended laboratory tests to identify avian influenza A virus in specimens from humans WHO Geneva June 2005.

   

H5N1, , , , , , , 20 22 F-H5 ACAAGGTCCGACTACAGCTT R-H5 ATTGATTCCAATTTTACTCCAC, 95% , 22 F-N1

CAGAACATTAATGAGTTGTCCT R-N1 TCTCAGTATGTTGTTCCTCCAA,

95% , ( ) 184 , , 213 , , .



Pages:     | 1 |   ...   | 3 | 4 ||
 

:

Ȼ 14.01.11 : , .. 2015 1. ...

- 03.01.06 ( ) , .. 2014 .....

13.00.01 , ...

: 03.02.08 , .. 2015 , . .. 5 1. . 19...

, 14.03.09 , : , ...

(SORBUS L.) 03.02.01 : ..., ... .. 2014 .. 4 1. .. 8 ...

14.02.01 : , ...







 
<<     |    
2016 www.konf.x-pdf.ru - - , ,

, .
, , , , 1-2 .