WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 


Pages:     | 1 |   ...   | 2 | 3 || 5 |

«РАЗРАБОТКА СРЕДСТВ ДЕТЕКЦИИ ВЫСОКОВИРУЛЕНТНОГО ШТАММА ВИРУСА ГРИППА А ПОДТИПА Н5N ...»

-- [ Страница 4 ] --

Higgins, A. Hampson, R. Shaw, T. Kok// J.Virol. Methods. – 2004. – Vol.117. – P. 103-112

124. Subbarao K. Characterization of an avian influenza A (H5N1) virus isolated from a child with a fatal respiratory illness / K. Subbarao, A. Klimov, J. Katz, H.

Regnery, W. Lim, H. Hall, M. Perdue, D. Swayne, C. Bender, J. Huang, M.

Hemphill, T. Rowe, M. Shaw, X. Xu, K. Fukuda, N. Cox// Science. – 1998. – Vol.279 – P.393–396

125. Suzuki Y. Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses / Y. Suzuki // Biol. Pharm. Bull. – 2005. – Vol.28.

– P.399-408

126. Takimoto S. Comparison of enzyme-linked immunosorbent assay, indirect immunofluorescence assay, and virus isolation for detection of respiratory viruses in nasopharyngeal secretions / S. Takimoto, M. Grandien, M.A. Ishida, M.S. Pereira, T.M. Paiva, T. Ishimaru, E.M. Makita, C.H. Martinez // Journal of clinical microbiology. – 1991. - Vol.29. – P.470–474

127. Thanh T.T. A real-time RT-PCR for detection of clade 1 and 2 H5N1 influenza A virus using locked nucleic acid (LNA) TaqMan probes / T.T.

Thanh, H.A. Pawestri, N.M. Ngoc, V.M. Hien, H. Syahrial, N.V. Trung, R.H.

van Doorn, H.F. Wertheim, N.V. Chau, Q. Ha do, J.J. Farrar, T.T. Hien, E.R.

Sedyaningsih, M.D. de Jong // Virol J. – 2010. – Vol.7. – P.46.

128. The Writing Committee of the World Health Organization (WHO) Consultation on Human Influenza A/H5 - N Engl J Med 2005; 353:1374-1385

129. The Writing Committee of the World Health Organization (WHO) Consultation on Human Influenza A/H5. Avian Influenza A (H5N1) Infection in Humans // N. Engl. J. Med. – 2005. – Vol. 353. – P.1374-1385.

130. Townsend M. B. Experimental Evaluation of the FluChip Diagnostic Microarray for Influenza Virus Surveillance / M. B. Townsend, E. D. Dawson, M. Mehlmann, et al. // J. Clin. Microbiol. – 2006. – Vol. 44(8). – P. 2863-2871

131. Tumpey T.M. Diagnostic approach for differentiating infected from vaccinated poultry on the basis of antibodies to NS1, the non-structural protein of influenza A virus / T.M. Tumpey, R. Alvarez, D.E. Swayne, D.L. Saurez //J Clin Microbiol. – 2005 – 43 (2): 676-683

132. Tumpey T.M. Resurrected pandemic influenza viruses / T.M. Tumpey, J.A.

Belser // Ann. Rev. Microbiol. – 2009. – Vol.63. – P.79-88 Ungchusak K. Probable person-to-person transmission of avian influenza A 133.

(H5N1) / K. Ungchusak, P. Auewarakul, S.F. Dowell, R. Kitphati, W. Auwanit, P. Puthavathana, M. Uiprasertkaul, K. Boonnak, C. Pittayawonganon, N.J. Cox, S.R. Zaki, P. Thawatsupha, M. Cittaganpitch, R. Khontong, J.M. Simmerman, S.

Chunsutthiwat // N Engl J Med. – 2005. – Vol.352 – P.333-340.

134. Vabred A. Comparison of three non-nested RT-PCR for the detection of influenza A viruses / A. Vabred, G. Sapin, B. Lezin, et al // J. of Clin. Vir. – 2000. – Vol. 17. – P. 167-175

135. van Elden L.J. Simultaneous detection of influenza viruses A and B using real-time quantitative PCR / L.J. van Elden, M. Nijhuis, P. Schipper, R.

Schuurman, A.M. van Loon // Journal of clinical microbiology. – 2001. – Vol.39. – P.196–200

136. Van Weemen B.K. Immunoassay using antigen-enzyme conjugates/ B.K.

Van Weemen, A.H. Schuurs // FEBS Lett. – 1971. – Vol.15, №3. – P.232-236

137. Velkov T. The antigenic architecture of the hemagglutinin of influenza H5N1 viruses/ T. Velkov, C. Ong, M.A. Baker, H. Kim, J. Li, R.L. Nation, J.X. Huang, M.A. Cooper, S. Rockman // Mol.Immunol. – 2013. – Vol.56,№4.

– P.705-719

138. Vernet G. Molecular diagnostics in virology / G. Vernet // J.Clin. Virol. – 2004. – Vol.31, №4. – Р. 239-247

139. Viljoen G.T. Molecular diagnostic PCR handbook/ G.T. Viljoen, L.H.Nel, J.R. Crowther//Netherlands: Springer, 2005 – 308 p.

140. Wang R. Methods for molecular surveillance of influenza / R. Wang, J.K.

Taubenberger // Expert Rev. Anti Infect. Ther. – 2010. - Vol.8. – P.517–527

141. Webster R. G. Influenza: an emerging disease / R. G. Webster// Emerg.

Infect. Dis. – 1998. – Vol. 4. – P. 436-441

142. Webster R.G. Changing epidemiology and ecology of highly pathogenic avian H5N1 influenza viruses / R.G. Webster, D.J. Hulse-Post, K.M. SturmRamirez, Y. Guan, M. Peiris, G. Smith, H. Chen // Avian Dis. – 2007. – Vol.51.

– P.269-272.

143. Webster R.G. Evolution and ecology of influenza A viruses/ R.G. Webster, W.J. Bean, O.T. Gorman, T.M. Chambers, Y. Kawaoka // Microbiol. Rev. – 1992. – Vol.56. – P.152-179

144. Webster R.G. H5N1 influenza–continuing evolution and spread / R.G.

Webster, E.A. Govorkova// N. Engl. J. Med. – 2006. Vol.355 – P.2174–2177.

145. World Health Organ. A revision of the system of nomenclature for influenza viruses: a WHO memorandum/ Bull. World Health Organ. – 1980. – Vol.58. – P.585–591

146. Wright K. E., Wilson G. A. R., Novosad D. Typing and subtyping of influenza viruses in clinical samples by PCR // J. of Clin. Microbiol. – 1995. – Vol. 33. – P. 1180-1184

147. Yassine H.M. Interspecies tramsmission of Influenza A viruses between swine and poultry / H.M. Yassine, C.W. Lee, Y.M. Saif // Curr. Top. Microbiol.

Immunol. – 2013. – Vol.370. – P. 227-240

148. Zambon M. C. Epidemiology and pathogenesis of influenza / M. C. Zambon // J. of Antimicrobial Chemotherapy. – 1999. – Vol. 44. – P. 3-9.

–  –  –

Предисловие

1.4 РАЗРАБОТАН: ЗАО «НПО НАРВАК»

Р

2. УТВЕРЖДЕН И ВВЕДЕН В ДЕЙСТВИЕ приказом директора ЗАО «НПО НАРВАК» № _____ от ___________________2007 г.

3. ВВОДИТСЯ ВПЕРВЫЕ

4. Настоящий стандарт организации разработан в соответствии с Федеральным законом «О техническом регулировании» от 27 декабря 2002 г. № 184-ФЗ и содержит нормы и требования к номенклатуре показателей качества, а также методам контроля, транспортирования, хранению и применению данного вида продукции, ее безопасности при производстве и использовании.

Настоящий стандарт не может быть полностью или частично воспроизведен и/или распространен без разрешения ЗАО «НПО НАРВАК».

–  –  –

1 ОБЛАСТЬ ПРИМЕНЕНИЯ

1.

1.1 Настоящий стандарт распространяется на «Тест-систему для обнаружения и дифференциации вируса гриппа А подтипа Н5N1 методом полимеразной цепной реакции».

1.2 Тест-система предназначена для обнаружения и дифференциации вируса гриппа А подтипа H5N1 в образцах сыворотки крови, органах больных птиц и млекопитающих и в инфицированных культурах клеток.

1.3 Положения настоящего стандарта обязательны для применения предприятием, осуществляющим производство и контроль качества тест-системы.

1.4 Настоящий стандарт может быть использован контролирующими организациями с целью подтверждения соответствия тест-системы установленным требованиям, в том числе для сертификации.

2 НОРМАТИВНЫЕ ССЫЛКИ

–  –  –

ГОСТ 12.1.

008-76 ССБТ. Биологическая безопасность. Общие требования ГОСТ 12.3.002-75 ССБТ. Процессы производственные. Общие требования

–  –  –

ГОСТ 6709-72 Вода дистиллированная. Технические условия

3 ТЕРМИНЫ И ОПРЕДЕЛЕНИЯ

3.1 Стандарт организации (СТО): Стандарт, утвержденный и применяемый организацией для целей, установленных статьей 17 Федерального закона «О техническом регулировании», для совершенствования производства и обеспечения качества продукции.

3.2 Удостоверение качества - документ о качестве, подтверждающий соответствие качества тест-системы требованиям стандарта.

3.3 Амплификатор – прибор для проведения полимеразной цепной реакции.

3.4 Праймер - специфические одноцепочечные участки ДНК.

4 ТРЕБОВАНИЯ БЕЗОПАСНОСТИ И ОХРАНЫ ОКРУЖАЮЩЕЙ СРЕДЫ

4.1 По биологической безопасности тест-системы должны соответствовать требованиям ГОСТ 12.1.008.

4.2 Производственный процесс должен быть организован в соответствии с требованиями ГОСТ 12.3.002.

4.3 Производственное оборудование должно соответствовать требованиям ГОСТ 12.2.003.

4.4 Общие санитарно-гигиенические требования к воздуху в рабочей зоне должны соответствовать требованиям ГОСТ 12.1.005.

4.5 Средства защиты работающих должны соответствовать требованиям ГОСТ 12.4.011.

4.6 Обучение рабочего персонала безопасности труда должно быть организовано в соответствии с требованиями ГОСТ 12.0.004.

4.7 В процессе производства должен быть налажен контроль допустимых выбросов в атмосферу согласно ГОСТ 17.2.3.02.

4.8 Требования безопасности, производственной санитарии выполняют в соответствии с «Правилами безопасности, производственной санитарии, охранно-карантинного и ветеринарно-санитарного режимов на предприятиях биологической промышленности», утвержденными Департаментом ветеринарии Минсельхозпрода РФ 07.06.1999 г.

4.9 Утилизация тест-систем, не прошедших контроль и с истекшим сроком годности, не требует специальных мер безопасности.

5 ТЕХНИЧЕСКИЕ ТРЕБОВАНИЯ

5.1 «Тест-система для обнаружения и дифференциации вируса гриппа А подтипа Н5N1 методом полимеразной цепной реакции (ПЦР)» включает три набора из ниже перечисленных компонентов, рассчитанных на проведение 50 анализов:

–  –  –

5.2 Тест-система должна соответствовать требованиям настоящего стандарта и изготавливаться согласно Инструкции по изготовлению и контролю тест-системы для обнаружения и дифференциации вируса гриппа А подтипа H5N1 методом полимеразной цепной реакции, утвержденной в установленном порядке.

5.2.1 Компоненты Набора-I для выделения РНК по своим физическим свойствам должны соответствовать требованиям и нормам, указанным в таблице 1.

–  –  –

5.2.2 Компоненты Набора II - для выявления РНК вируса гриппа А подтипа H5N1 методом ПЦР по своим физическим и биологическим свойствам должны соответствовать требованиям и нормам, указанным в таблице 2.

–  –  –

5.2.3 Компоненты Набора III - для проведения электрофореза по своим физическим свойствам должны соответствовать требованиям и нормам, указанным в таблице 3.

–  –  –

5.3 Упаковка и маркировка 5.3.1 Компоненты наборов расфасовывают в стерильные пробирки типа «Эппендорф» или флаконы и пробирки вместимостью 5-25 мл с завинчивающейся крышкой. На пробирках и флаконах с каждым компонентом должна быть этикетка с указанием краткого названия компонента.

5.3.2 Флаконы и пробирки упаковывают в полиэтиленовые пакеты с указанием:

организации-производителя и ее товарного знака, наименования каждого набора, номера серии и контроля, даты изготовления и срока годности, условий хранения.

5.3.3 Наборы I и III упаковывают в картонные коробки. На каждую коробку наклеивают этикетку c указанием наименования организации-производителя и ее товарного знака, полного названия тест-системы, номера серии и контроля, даты изготовления, срока годности, условий хранения, количества анализов и обозначения СТО. В коробку вкладывают инструкцию по применению тест-системы. Набор II упаковывают и маркируют по п. 5.3.2.

6 ПРАВИЛА ПРИЕМКИ

6.1. Каждая серия Тест-системы для обнаружения и дифференциации вируса гриппа А подтипа Н5N1 методом полимеразной цепной реакции должна быть принята (проверена) контролером организации-производителя.

6.2 Для проверки качества от каждой серии тест-систем контролер делает выборку в количестве 6 штук, из которых 3 используют для испытания на показатели качества, а оставшиеся 3 тест-системы хранят в архиве в течение срока годности.

6.3 Каждая серия тест-систем сопровождается удостоверением качества, в котором указывают: организацию-производителя, наименование тест-системы, номер серии, номер контроля, дату изготовления (месяц, год), срок годности, результаты контроля качества, обозначение СТО, заключение, дату выдачи. Удостоверение качества подписывает лицо, выдавшее документ.

6.4 Предназначенные для хранения в архиве образцы опечатывают и снабжают документом установленной формы с указанием: наименования тест-системы, даты изготовления, номера серии, срока годности и даты направления для хранения в архив, условий хранения и обозначения СТО.

6.5 При получении неудовлетворительных результатов хотя бы по одному из показателей проводят повторную проверку на этот показатель на удвоенном количестве образцов тест-системы, отобранных из той же серии и на удвоенном количестве материалов.

При неудовлетворительных результатах повторного контроля серию считают несоответствующей требованиям настоящих СТО и выбраковывают.

6.6 Контроль тест-систем, поступивших с рекламацией, проводит организацияпроизводитель и, при необходимости, профильная лаборатория в ФГУ ВГНКИ.

7 МЕТОДЫ ИСПЫТАНИЙ

7.1 Определение внешнего вида, цвета, наличия посторонних примесей компонентов тест-систем Внешний вид, наличие посторонних примесей, осадка, хлопьев определяют визуально. В компонентах не должно содержаться посторонних примесей, плесени и т.д.

Одновременно флаконы и пробирки проверяют на плотность укупорки и правильность этикетирования.

7.2 Определение активности компонентов тест-систем 7.2.1 Аппаратура, материалы и реактивы

- пипеточные дозаторы следующих объемов: 0-20 мкл, 0-200 мкл, 0-1000 мкл с использованием наконечников одноразового использования.

- пробирки емкостью 1,5 мл, 0,5 мл

- холодильник бытовой

- микроцентрифуга типа «Эппендорф»

- твердотельный термостат

- амплификатор

- прибор для горизонтального электрофореза

- ультрафиолетовый трансиллюминатор, фотоаппарат с оранжевым светофильтром

- дистиллированная вода по ГОСТ 6709

- образцы для исследования (таблица 4)

–  –  –

7.2.2 Проведение испытания 7.2.2.1 Выделение РНК из исследуемого биологического материала проводят с помощью Набора - I для выделения РНК.

Во избежание перекрестной контаминации до начала работы маркируют чистые пробирки объемом 1.5 мл и вносят в них по 600 мкл раствора №1. После этого приступают к работе с инфицированным материалом. На всех этапах исследования в первую очередь проводят манипуляции с отрицательным контролем, затем с исследуемыми образцами и в последнюю очередь с положительным контролем.

Положительными контролями служат генноинженерные препараты, содержащие гены гемагглютинина Н5 и нейраминидазы N. Аликвоту с положительным контролем размораживают непосредственно перед использованием, повторной заморозке не подлежит. Для выделения РНК используют 200 мкл. В качестве отрицательного контроля используют деионизованную воду.

По 200 мкл каждого образца панели и контрольных образцов добавляют в подготовленные пробирки, содержащие 600 мкл раствора-1. Инкубируют 10-15 мин при комнатной температуре, периодически плавно перемешивая. Центрифугируют в настольной центрифуге типа “Эппендорф” 1 мин при 13000 об/мин. Надосадочную жидкость переносят в чистые пробирки, а осадок отбрасывают.

К надосадочной жидкости добавляют 40 мкл сорбента (сорбент перед использованием необходимо тщательно ресуспендировать), инкубируют при комнатной температуре (20+2оС) в течение 10 мин, 1-2 раза перемешивая на смесителе типа “Vortex”.

Центрифугируют 10-15 сек на микроцентрифуге при 6000-13000 об/мин, надосадочную жидкость отбрасывают.

К осадку добавляют 100 мкл раствора №2, суспендируют и осаждают сорбент центрифугированием в течение 15 сек, надосадочную жидкость отбрасывают. Процедуру повторяют 2 раза.

К осадку добавляют 100 мкл раствора №3, перемешивают, центрифугируют 15 сек, надосадочную жидкость отбрасывают. Процедуру повторяют 2 раза.

Осадок подсушивают в течение 5-10 мин при 56оС в пробирке с открытой крышкой.

К осадку добавляют 30 мкл деионизованной воды для элюции РНК с сорбента, перемешивают и инкубируют 10-15 мин при 56оС в закрытых пробирках.

Центрифугируют в течение 0,5 мин при 13000 об/мин. Отобранную надосадочную жидкость используют для проведения ПЦР.

На всех стадиях обработки биоматериала удаления супернатанта производить одноразовыми пластиковыми наконечниками при помощи водоструйного насоса в колбуловушку с дезинфицирующим раствором (3% хлорамин или 5% перекись водорода и т.п.).

7.2.2.2 Полимеразную цепную реакцию проводят с компонентами Набора II – для выявления РНК вируса гриппа А подтипа H5N1 методом ПЦР Для определения подтипа H5N1 вируса гриппа А необходимо каждый образец проанализировать на два гена – H и N, используя праймеры для Н5 и N1.

–  –  –

Смесь перемешивают, избегая образования пены, и немедленно раскапывают по 20 мкл в предварительно промаркированные пробирки, в каждую пробирку добавляют по 2-3 капли масла (примерно 40 мкл).

Затем в них вносят под масло по 5 мкл РНК соответствующих анализируемых и контрольных образцов. Пробы вносят в амплификатор со следующим температурным режимом:

–  –  –

ПЦР-N1. В отдельной пробирке готовят общую реакционную смесь на n образцов (n

– количество проб с учетом положительного и отрицательного контролей). Реактивы вносят в количестве и последовательности, указанных в таблице 2. Ферменты добавляют в последнюю очередь. При составлении смеси ферменты следует держать во льду.

–  –  –

Смесь перемешивают, избегая образования пены, и немедленно раскапывают по 20 мкл в предварительно промаркированные пробирки, в каждую пробирку добавляют по 2-3 капли масла (примерно 40 мкл).

Затем в них под слой масла вносят по 5 мкл РНК соответствующих анализируемых и контрольных образцов. Пробы вносят в амплификатор со следующим температурным режимом:

–  –  –

7.2.3 Обработка результатов Результаты ПЦР анализируют методом электрофореза в агарозном геле с помощью Набора III - для электрофореза.

7.2.3.1 Приготовление буфера для электрофореза Для приготовления 1 л однократного буфера для электрофореза к 20 мл 50хТАЕ буфера добавляют 980 мл дистиллированной воды и 40 мкл раствора бромистого этидия.

Примечание: Буфер можно приготовить самостоятельно по следующей прописи:

навеску 4,04 г основного триса растворяют в 200 мл дистиллированной воды, добавляют 1,14 мл ледяной уксусной кислоты и 2 мл 0,5 М раствора ЭДТА рН 8,0 и доводят объём буфера до 1000 мл дистиллированной водой. После растворения компонентов добавляют 40 мкл раствора бромистого этидия.

Внимание! Бромистый этидий является мутагеном, проникающим через кожу. При работе с ним использовать резиновые перчатки!

Бромистый этидий разлагается на свету и при нагревании. Содержащие его растворы хранят в темном месте. При длительном хранении или многократном нагревании в них следует внести свежую порцию бромистого этидия (5 мкл на 100 мл буфера) перед употреблением.

7.2.3.2 Приготовление агарозного геля В термостойкой посуде готовят необходимый объем 2% суспензии агарозы на однократном буфере для электрофореза и нагревают на электроплите или в микроволновой печи до полного растворения агарозы. Расплавленную агарозу охлаждают до 45оС, постоянно перемешивая, заливают в специальную форму с гребёнкой и дают затвердеть. Форму с образовавшимся агарозным гелем переносят в аппарат для горизонтального электрофореза, погружают в буфер и осторожно вынимают гребёнку.

Оставшуюся часть затвердевшей агарозы можно повторно расплавить и использовать для приготовления геля.

7.2.3.3 Электрофорез продуктов амплификации К 7 мл полученной амплификационной смеси (водной фазы) добавляют 3 мкл буфера для нанесения образца, перемешивают пипетированием и полученный образец вносят в лунку агарозного геля (лунки, образовавшиеся от зубцов гребенки).

Электрофорез проводят при напряжении 8 вольт/см длины геля до тех пор, пока краситель пройдет от старта не менее половины геля (примерно 30-60 мин). Направление движения образцов в геле от “минуса” к “плюсу“!

7.2.3.4 Учет результатов электрофореза Результаты учитывают, просматривая гель в ультрафиолетовом свете с длиной волны 254 нм на приборе «Трансиллюминатор». Амплифицированные фрагменты ДНК выявляются в виде светящихся красноватых полос.

Внимание! Ультрафиолет вызывает ожоги слизистой оболочки глаз. При просмотре гелей пользоваться защитным экраном или очками.

7.2.3.5 Интерпретация результатов Компоненты набора считаются активными, и набор подлежит реализации, если все контрольные показатели соответствуют следующим критериям:

При проведении ПЦР достаточно по 5 мкл положительных контролей (генноинженерные препараты, содержащие гены гемагглютинина Н5 и нейраминидазы N1) для получения фрагментов длиной 184 п. о. (подтип Н5) и 213 п. о (подтип N1) после амплификации с 4,5 мкл соответствующих праймеров.

В отрицательном контроле не должно выявляться никаких полос. Присутствие в отрицательном контроле окрашенных фрагментов на уровне полос положительных контролей свидетельствует о перекрестной контаминации в процессе анализа. Результаты аннулируются. Анализ необходимо провести заново.

Положительными (подтип Н5N1) считают пробы, в которых выявляются фрагменты, соответствующие фрагментам и Н5 и N1 положительных контролей. Исследуемые пробы считают отрицательными, если в них не выявлено никаких полос или полосы не соответствуют по размеру фрагментам в контрольных положительных пробах (т. е.

располагаются на другом расстоянии от старта) или выявлены полосы, соответствующие фрагментам только Н5 или только N1.

7.3 Определение специфичности компонентов тест-системы 7.3.1 Аппаратура, материалы и реактивы Для проведения испытания используют аппаратуру и материалы, а также панель исследуемых проб, указанные в п. 7.2.1.

7.3.2 Проведение испытания Выделение РНК, постановку ПЦР и обработку результатов осуществляют аналогично п.7.2.2 настоящего CТО.

7.3.3 Интерпретация результатов Компоненты набора считают специфичными и набор подлежит реализации, если все контрольные показатели соответствуют следующим критериям:

Праймеры Н5 и N1 должны вступать в реакцию только с образцами положительного контроля и пробами, инфицированными вирусом гриппа А, содержащими подтипы Н5 и/или N1. С отрицательным контролем и пробами, не содержащими вирус гриппа А H5 и/или N1, реакция должна быть отрицательной.

8 ТРАНСПОРТИРОВАНИЕ И ХРАНЕНИЕ

8.1 Хранение наборов I и III осуществляют при температуре от 2 С до 6 С, набора II - при температуре от минус 18 С до минус 20 С.

8.2 Транспортирование тест-систем проводится в теплоизолирующей упаковке (термос, пенопластовая коробка) при температуре от 2С до 6С. Набор II транспортируют во льду.

9 УКАЗАНИЯ ПО ПРИМЕНЕНИЮ

Тест-системы для обнаружения и дифференциации вируса гриппа А подтипа Н5N1 методом полимеразной цепной реакции применяют в соответствии с Инструкцией по применению, утвержденной Россельхознадзором.

10 ГАРАНТИИ ПРОИЗВОДИТЕЛЯ

10.1 Организация-производитель гарантирует соответствие качества Тест-системы для обнаружения и дифференциации вируса гриппа А подтипа Н5N1 методом полимеразной цепной реакции требованиям настоящего стандарта при соблюдении правил транспортирования, хранения и применения, установленных настоящим стандартом.

10.2 Срок годности тест-системы – 12 месяцев с даты изготовления. Датой изготовления считают дату комплектации наборов.

УДК ОКС 11.220 ОКП 93 8820 Ключевые слова: тест-система, полимеразная цепная реакция, грипп птиц, активность, специфичность, обнаружение, дифференциация, вирус гриппа А подтип H5N1.

–  –  –

4 Буфер для нанесения образца 0,3 см 2 пробирки Тест-система предназначена для обнаружения и дифференциации вируса гриппа А подтипа Н5N1 методом полимеразной цепной реакции (ПЦР) в образцах сыворотки крови, патматериале от птиц и млекопитающих и в инфицированных культурах клеток.

При точном соблюдении инструкции по применению анализ занимает от 8 до16 часов (в зависимости от условий выделения).

1.3 Упаковка и маркировка Компоненты тест-систем расфасовывают в полипропиленовые флаконы с завинчивающимися крышками вместимостью 20 мл, пробирки вместимостью 0,5-2,0 мл и 5 мл. На пробирки и флаконы наклеивают этикетку с указанием краткого названия компонента.

Флаконы и пробирки каждого набора отдельно упаковывают в полиэтиленовые пакеты с указанием: организации-производителя и разработчика и/или товарного знака, наименования каждого набора, номера серии и контроля, даты изготовления и срока годности, условий хранения.

Наборы I и III упаковывают в картонные коробки. На каждую коробку наклеивают этикетку или наносят несмываемой краской следующие обозначения: страна, город, название организации-производителя и разработчика и/или товарный знак, полное название тест-системы, номер серии и контроля, дату изготовления (месяц, год), срок годности (месяц, год), предупредительную надпись «Для животных», номер государственной регистрации, знак соответствия в системе ГОСТ Р, условия хранения, количество анализов и обозначение нормативного документа. В коробку вкладывают инструкцию по применению тест-системы.

1.4. Условия хранения Хранение Наборов I и III осуществляется при температуре от 2 0С до 60С, Набора II – при температуре от минус 180С до минус 200С.

Транспортирование тест-системы проводят в теплоизолирующей упаковке (термос, пенопластовая коробка) при температуре от 20С до 60С. Компоненты Набора II транспортируют во льду.

Срок годности тест-системы: 12 месяцев от даты изготовления. Запрещено использовать тест-систему по окончании срока годности.

Флаконы и пробирки без этикеток, с нарушением целостности, изменением консистенции или цвета компонентов, при наличии плесени или других примесей и не использованные в течение срока годности подлежат выбраковке. Обеззараживание биоматериала и реагентов проводят, помещая одноразовую пластиковую посуду (пробирки, флаконы, наконечники) на 20-24 ч в специальный контейнер, содержащий 0,2% раствор ДП-2Т.

II ПРИНЦИП ДЕЙСТВИЯ

2 В основе ПЦР лежит многократное повторение циклов денатурации исследуемой ДНК при температуре 94°С, гибридизации ДНК со специфическими праймерами при температуре 60°С и синтеза с них комплементарных цепей ДНК с помощью термостабильной ДНК-полимеразы при температуре 72°С. В результате амплификации концентрация синтезированного фрагмента в исследуемой пробе увеличивается в миллионы раз, что позволяет визуально учитывать результаты анализа с помощью электрофореза в агарозном геле.

Вирус гриппа А отличается высокой степенью вариабельности, особенно это касается поверхностных гликопротеинов вириона: гемагглютинина (Н) и нейраминидазы (N). Известно 16 антигенных подтипов гемагглютинина (Н1-Н16) и 9 подтипов нейраминидазы (N1-N9). Наиболее эпизоотически опасным считают вирус гриппа А подтипа H5N1.

Анализ по выявлению и дифференциации вируса гриппа А подтипа Н5N1 включает:

выделение суммарной РНК, проведение реакции обратной транскрипции и амплификации специфических фрагментов в полимеразной цепной реакции (ОТ-ПЦР) c двумя парами специфических праймеров (Н5 и N1) и электрофорез в агарозном геле.

–  –  –

3.1 Подготовка к работе.

3.1.1 Необходимые условия успешного проведения анализа Строго соблюдать условия хранения и транспортировки компонентов тест-системы (см. п. 1.4).

Посуда для отбора образцов биоматериала должна быть одноразовой или тщательно обработана хромпиком, отмыта, простерилизована.

Пробирки с вирусным материалом должны быть всегда закрытыми. При отборе вируссодержащих суспензий работать наконечниками с фильтром.

На всех стадиях обработки биоматериала удаление супернатанта производить одноразовыми пластиковыми наконечниками при помощи водоструйного насоса в колбуловушку с дезинфицирующим раствором (3% хлорамин или 5% перекись водорода и т.

п.).

Однократно использовать пластиковую посуду (наконечники и пробирки). Ранее использованные и мытые наконечники и пробирки использовать нельзя!

При составлении смеси для амплификации сначала готовить отрицательный контроль, а последним - положительный контроль.

Перед открыванием пробирок капли жидкости на крышке удалять центрифугированием.

При открывании и закрывании пробирок избегать случайного касания руками или инструментами внутренней поверхности крышек.

Бромистый этидий разлагается на свету и при нагревании. Содержащие его растворы хранят в темном месте. При длительном хранении или многократном нагревании в них следует внести свежую порцию бромистого этидия (5 мкл на 100 мл буфера) перед употреблением.

3.1.2. Подготовка исследуемого материала Исследуемый материал отбирают в одноразовую пластиковую посуду и транспортируют во льду. Не допускается многократное замораживание и размораживание материала для исследования.

КРОВЬ: допускается замораживание до исследования при температуре от минус 180С до минус 200С, 200 мкл крови переносят в полипропиленовую пробирку на 1,5 мл и используют для анализа.

СЫВОРОТКА КРОВИ: допускается замораживание при температуре от минус 18 0С до минус 200С, 200 мкл сыворотки крови переносят в полипропиленовую пробирку на 1,5 мл и используют для анализа.

ТКАНИ: кусочек ткани измельчают ножницами и растирают в физиологическом растворе или в растворе для выделения №1 (готовят примерно 10% суспензию), 200 мкл суспензии переносят в полипропиленовую пробирку на 1,5 мл и используют для выделения РНК.

КОНТРОЛИ: Положительными контролями служат генноинженерные препараты, содержащие гены гемагглютинина Н5 и нейраминидазы N1. Аликвоту с положительным контролем размораживают непосредственно перед использованием, повторной заморозке не подлежит. Для выделения используют 200 мкл. В качестве отрицательного контроля используют деионизованную воду.

3.2. Выделение РНК для анализа Выделение РНК из исследуемого биологического материала проводят с помощью Набора I - для выделения РНК. Во избежание перекрестной контаминации до начала работы маркируют чистые пробирки объемом 1,5 мл и вносят в них по 600 мкл раствора №1. После этого приступают к работе с инфицированным материалом.

Образцы исследуемого биологического материала (в объеме 200 мкл) добавляют в подготовленные пробирки, содержащие 600 мкл раствора №1.

Инкубируют 10 мин при комнатной температуре (20±2)0С, периодически плавно перемешивая. Центрифугируют в настольной центрифуге типа “Эппендорф” 1 мин при 13000 об/мин. Надосадочную жидкость переносят в чистые пробирки, а осадок отбрасывают.

К надосадочной жидкости добавляют 40 мкл сорбента (сорбент перед использованием необходимо тщательно ресуспендировать), инкубируют при комнатной температуре (20±2)0С в течение 10 мин, 1-2 раза перемешивая на смесителе типа “Vortex”.

Центрифугируют 10-15 сек на микроцентрифуге при 6000 - 13000 об/мин, надосадочную жидкость отбрасывают.

К осадку добавляют 100 мкл раствора № 2, суспендируют и осаждают сорбент центрифугированием в течение 15 сек, надосадочную жидкость отбрасывают. Процедуру повторяют 2 раза.

К осадку добавляют 100 мкл раствора № 3, перемешивают, центрифугируют 15 сек, надосадочную жидкость отбрасывают. Процедуру повторяют 2 раза.

Осадок подсушивают в течение 5-10 мин при 560С в пробирке с открытой крышкой.

К осадку добавляют 30 мкл деионизованной воды для элюции РНК с сорбента, перемешивают и инкубируют 10-15 мин при 560С в закрытых пробирках, 2-3 раза встряхивая на смесителе типа “Vortex”. Центрифугируют в течение 0,5 мин при 13000 об/мин. Отобранную надосадочную жидкость используют для проведения ПЦР.

Выделенную РНК хранить при температуре от минус 180С до минус 200С.

–  –  –

3.3.2 ПЦР-N1.

В отдельной пробирке готовят общую реакционную смесь на n образцов (n – количество проб с учетом положительного и отрицательного контролей). Реактивы вносят в количестве и последовательности, указанной в таблице 2. Ферменты добавляют в последнюю очередь. При составлении смеси ферменты следует держать во льду.

–  –  –

Результаты исследования учитываются путем анализа продуктов амплификации исследуемых образцов методом электрофореза в агарозном геле (Набор III - для проведения электрофореза).

4.1 Приготовление буфера для электрофореза Для приготовления 1 л однократного буфера для электрофореза к 20 мл 50хТАЕ буфера добавить 980 мл дистиллированной воды и 40 мкл раствора бромистого этидия.

Буфер можно приготовить самостоятельно по следующей прописи: навеску 4,04 г Триса растворяют в 200 мл дистиллированной воды, добавляют 1,14 мл ледяной уксусной кислоты и 2 мл 0,5 М раствора ЭДТА рН 8,0 и доводят объём буфера до 1000 мл дистиллированной водой. После растворения компонентов буфера добавляют 40 мкл раствора бромистого этидия.

4.2 Приготовление агарозного геля К 100 мл однократного буфера для электрофореза добавляют 2 г агарозы, доводят до кипения и охлаждают до 450С. Заливают в специальную форму с гребёнкой и дают затвердеть. Гребёнку осторожно вынимают, форму с агарозой переносят в аппарат для горизонтального электрофореза (ПГ-9 “Диа - М”) и погружают в буфер.

4.3 Электрофорез продуктов амплификации К 7 мкл полученной амплификационной смеси (водной фазы) добавляют 3 мкл буфера для нанесения образца, перемешивают пипетированием и полученный образец вносят в лунку агарозного геля (лунки, образовавшиеся от зубцов гребёнки).

Электрофорез проводят при напряжении 8 вольт/ см длины геля. Краситель должен пройти не менее половины геля. Направление движения образцов в геле от “-” к “+“!

4.4 Учет результатов электрофореза Результаты электрофореза просматривают в ультрафиолетовом свете с длиной волны 254 нм на приборе "Трансиллюминатор". Результаты реакции выявляются в виде светящихся красноватых полос.

Положительными (подтип Н5N1) считают пробы в которых выявлены фрагменты, соответствующие фрагментам и Н5 и N1 положительных контролей.

Исследуемые пробы считают отрицательными, если в них не выявлено никаких полос, полосы не соответствуют по размеру фрагментам в контрольных положительных пробах (т. е. располагаются на другом расстоянии от старта) или выявлены полосы, соответствующие фрагментам только Н5 или только N1.

Размеры фрагментов должны соответствовать следующим показателям:

Подтип Размер фрагмента Н5 184 п.н.

213 п. н.

N1 В отрицательном контроле не должно выявляться никаких полос.

Присутствие в отрицательном контроле окрашенных фрагментов на уровне полос положительного контроля свидетельствует о перекрестной контаминации в процессе анализа. Результаты аннулируются. Анализ необходимо провести заново.

Для документирования полученных результатов используют фотопленку «Микрат– 300» и аппарат типа "Зенит” с оранжевым светофильтром, либо другие фото- и видеосистемы.

V МЕРЫ ЛИЧНОЙ ПРОФИЛАКТИКИ

5.1 Бромистый этидий является мутагеном, проникающим через кожу. При работе с ним использовать резиновые перчатки!

5.2 Ультрафиолет вызывает ожоги слизистой оболочки глаз. При просмотре гелей пользоваться защитным экраном или очками.

5.3 Работу с химическими компонентами и биологическим материалом следует проводить с соблюдением правил техники безопасности. При случайном попадании их на кожу или слизистые оболочки рекомендуется промыть это место большим количеством водопроводной воды.

5.4 Запрещается во время работы с компонентами тест-системы прием пищи, воды, курение.

5.5 Тест-систему следует хранить в местах, недоступных для детей.

Инструкция разработана ООО «Ветбиохим». Организация-производитель – ООО «Ветбиохим». Адрес производства: 123098, г. Москва, ул. Гамалеи, д.16 С утверждением настоящей инструкции утрачивает силу инструкция по применению тест-системы для обнаружения и дифференциации вируса гриппа А подтипа Н5N1 методом полимеразной цепной реакции, утвержденная Россельхознадзором 29 декабря 2007 г.

Рекомендовано к регистрации в Российской Федерации ФГУ ВГНКИ.

Регистрационный номер ПВР-1-4.7/02562

–  –  –

(56) Список документов, цитированных в (73) Патентообладатель(и):

о Государственное учреждение Научноотчете поиске: PAYUNGPORN S. et al., "Single- исследовательский институт вирусологии transcription- им. Д.И. Ивановского Российской step multiplex reverse polymerase chain reaction (RT-PCR) for академии медицинских наук (RU) influenza A virus subtype H5N1 detection", Viral Immunol. 2004; 17 (4): 588-93. CN 101016570, 15.08.2007. CN 1693477, 09.11.2005.

Адрес для переписки:

123098, Москва, ул. Гамалеи, 16, ГУ НИИ вирусологии им. Д.И. Ивановского РАМН, патентно-лицензионная группа

(54) СПОСОБ ОБНАРУЖЕНИЯ ВИРУСА ГРИППА А ПОДТИПА H5N1

(57) Реферат:

Изобретение относится к молекулярной биологии, вирусологии. Способ предусматривает проведение реакции обратной транскрипции с РНК вируса, совмещенной с реакцией амплификации на два гена, анализ реакционной смеси с помощью электрофореза в агарозном геле и выявление РНК штаммов вирусов гриппа А по результатам анализа.

Способ позволяет осуществлять одностадийную экспресс-идентификацию вируса гриппа А подтипа H5N1. Изобретение может быть использовано для обнаружения вируса гриппа типа А подтипа H5N1, основанного на детекции генетического материала возбудителя, и предназначено для массовых анализов с возможной автоматизацией процесса. 1 ил., 1 табл.

Изобретение относится к молекулярной биологии, вирусологии и может быть использовано для обнаружения вируса гриппа типа А подтипа H5N1, основанного на детекции генетического материала возбудителя, и предназначено для массовых анализов с возможной автоматизацией процесса.

Вирус гриппа типа А относится к семейству Orthomyxoviridae, широко распространен в природе, поражает многие виды млекопитающих и птиц, в основном водного и околоводного комплекса, и способен вызывать эпидемии, пандемии и эпизоотии (Brown I.H. at al 1993, 1995, 1998). Вирус гриппа А отличается высокой степенью вариабельности, особенно это касается поверхностных гликопротеинов вириона: гемагглютинина (НА) и нейраминидазы (NA). Известно 16 антигенных подтипов гемагглютинина (HI-HI5) и 9 подтипов нейраминидазы (N1-N9).

Вирусы гриппа А подтипа H5N1 периодически выделялись от кур и других видов птиц (Castrucci, M.R., et al 1993, Cauthen AN et al 2000). В 1997 году в Гонконге отмечена вспышка заболевания, обусловленная прямой передачей вируса гриппа птиц H5N1 от кур человеку (Capua I. et al 2002). Наблюдается распространение гриппа птиц, вызванного вирусом H5N1, в странах Азии и Европы (Li, Wang J. et al 2004). В течение 2004 года ВОЗ постоянно информировал о случаях заражения людей гриппом птиц, причем болезнь протекала с летальностью более 70%. В 2005 г. отмечены эпизоотии среди птиц в Сибири, на Дальнем востоке, в Калмыкии, Астрахани и других районах Российской Федерации.

Доказано, что подтип H5N1 вируса гриппа А способен мутировать с высокой скоростью и образовывать высоко патогенные штаммы вируса гриппа, которые в будущем могут представлять серьезную эпидемическую опасность (Li, Wang J. et al 2004).

Классическими методами диагностики данного возбудителя являются реакция торможения гемагглютинации, реакция связывания комплемента, реакция нейтрализации, позволяющие определять наличие вирусных антигенов, а также метод иммуноферментного анализа, позволяющий определять наличие антител к вирусным антигенам в сыворотках крови. Кроме этого, существует ряд наборов для выявления в биологических пробах генетического материала вируса гриппа А методом полимеразной цепной реакции (WHO 2005), (Payungporn S. Et al, 2004). Научная публикация, представляющая описание тест-системы ПЦР для определения РНК вируса гриппа, описывает способ диагностики, отличающийся от предлагаемого изобретения специфическими компонентами и методическими подходами.

Технической задачей изобретения является создание способа одностадийной экспрессидентификации вируса гриппа А подтипа H5N1. При этом методика может проводиться как в двух ПЦР, так и с использованием мультиплексной ПЦР (идентификация двух генных участков в одной реакции ПЦР). Мультиплексная ПЦР позволит выявлять вирусный материал в одной реакционной смеси, сократив время диагностики, процент финансовых затрат и технологических ошибок.

Поставленная задача решается путем подбора пар олигонуклеотидных праймеров, специфичных для вируса гриппа А подтипа H5N1.

Для подбора праймеров использовали более 10000 последовательностей генов НА и NA вируса гриппа А различных подтипов, выделенных до 2007 года. Последовательности были проанализированы с использованием программ Alignment Service и Lasergene (версия 6.0). Уровень гомологии подобранных праймеров не менее чем 95%.

Сущность изобретения заключается в том, что разработан способ выявления вируса на основе амплификации участка кДНК вируса гриппа А с помощью совмещенной реакции обратной транскрипции и полимеразной цепной реакции (ОТ-ПЦР) участка вирусного гена гемагглютинина и нейраминидазы для увеличения количества копий ДНК вируса гриппа А подтипа H5N1. При этом уровень гомологии подобранных праймеров составляет не менее 95% для обоих генов. Вирус выявляется, если после разделения части реакционной смеси в агарозном геле в анализируемом образце выявляются фрагменты ДНК размером 184 нуклеотидных пар для праймеров, специфичных Н5, и 213 нуклеотидных пар для праймеров, специфичных N1.

Праймеры подбирали и анализировали с использованием программы Oligo (версия 3.3.) (Breslauer et al 1986).

Отсутствие гомологии с другими вирусами семейства Orthomyxoviridae и с другими подтипами вируса гриппа А являлось основным критерием отбора олигонуклеотидов.

Таким образом, для каждого гена (НА и NA) вируса гриппа А подтипа H5N1 была подобрана пара праймеров, которая высококонсервативна и специфична к своему подтипу и не имеет гомологии с другими подтипами вируса гриппа А и с другими родственными вирусами.

Схемы и расчетные фрагменты ПЦР представлены на чертеже.

Рассчитанные олигонуклеотиды были синтезированы на автоматическом синтезаторе 349 DNA/RNA synthesizer (Applied Biosystems (США)) по стандартной методике.

Предложенный способ включает в себя две основные реакции. Первая - это первая ОТПЦР с праймерами, специфичными к участку гена гемагглютинина вируса гриппа А.

Матрицей для этой реакции служит одноцепочечная РНК вируса гриппа, а затравкой праймеры F-H5, состоящий из 20 звеньев: ACAAGGTCCGACTACAGCTT, и R-H5, состоящий из 22 звеньев: ATTGATTCCAATTTTACTCCAC. Вторая реакция - вторая ОТПЦР с праймерами, специфичными к участку гена нейраминидазы. Матрицей для этой реакции служит одноцепочечная РНК вируса гриппа, а затравкой - праймеры F-N1, состоящий из 22 звеньев: CAGAACATTAATGAGTTGTCCT, и R-N1, состоящий из 22 звеньев: TCTCAGTATGTTGTTCCTCCAA. Применение полимеразной цепной реакции, совмещенной с реакцией обратной транскрипции, сокращает время проведения реакции.

Реакционную смесь анализируют с помощью электрофореза в 2% агарозном геле.

Присутствие в анализируемом образце фрагментов ДНК размером 184 нуклеотидных пар свидетельствует о наличии в исходном материале РНК вируса гриппа А подтипа Н5, а фрагменты ДНК размером 213 нуклеотидных пар - вируса гриппа А подтипа N1.

Предложенный метод диагностики вируса гриппа А методом ПЦР является высокочувствительным и высокоспецифичным к вирусу гриппа А подтипа H5N1 и позволяет достоверно определять наличие РНК вируса данного подтипа в биологических пробах без предварительного накопления тестируемого вируса, что особенно важно при работе с высокопатогенными штаммами.

Изобретение иллюстрируется следующими примерами.

Пример 1. Выбор последовательности праймеров.

Учитывая большую вариабельность генома вируса гриппа типа А, при его обнаружении необходимо использовать праймеры, соответствующие наиболее консервативным участкам вирусного генома. Основой для поиска мест отжига праймеров стало сопоставление нуклеотидных последовательностей гена гемагглютинина и нейраминидазы всех вирусов гриппа, представленных в международной базе данных.

Всего использовали более 10000 нуклеотидных последовательностей геномов вирусов гриппа.

При выборе мест посадки праймеров учитывались следующие требования: специфичность праймеров для всех последовательностей вирусов подтипа H5N1, отсутствие мест отжига праймеров на последовательности вирусов других подтипов. Эта работа выполнялась с помощью программ Lasergene (версия 6.0), BioEdit (версия 7.00) и Amplify (версия 1.06 Univers. of Wisconsin, Genetics, Madison). В качестве дополнительных критериев, определяющих пригодность праймеров, учитывались следующие: отсутствие дуплексов праймеров и отжига их друг на друга, отсутствие мест ложного отжига на матрицы геномов различных штаммов вируса гриппа А и родственных вирусов. Этим критериям удовлетворяют все отобранные праймеры.

Пример 2. Выделение РНК из образцов.

Выделить РНК из образцов - это получить ее в чистом виде, т.е. отделить от белков и других клеточных молекул, которые могут помешать молекулярному анализу. Во избежание перекрестной контаминации до начала работы маркировали чистые пробирки объемом 1.5 мл и вносили в них по 600 мкл раствора, содержащего гуанидинтиоцианат.

Образцы исследуемого материала (в объеме 200 мкл) использовали для анализа.

Использовали метод выделения с неорганического сорбента "SiO2". РНК элюировали в 30 мкл деионизованной воды, свободной от РНК-аз при 56°С в закрытых пробирках.

Пример 3. Проведение ОТ-ПЦР с праймерами, специфичными к участкам генов Н5 и N1.

В отдельной пробирке готовят общую реакционную смесь на N образцов, в число которых входят положительный и отрицательный контроли. Реактивы вносят в последовательности, приведенной в таблице. Ферменты добавляют в последнюю очередь.

–  –  –

Смесь перемешивают и раскапывают по 20 мкл в пробирки, в каждую пробирку добавляют по 2-3 капли масла (примерно, 40 мкл).

Затем в них вносят отдельным наконечником с фильтром под масло по 5 мкл РНК соответствующих анализируемых или контрольных образцов (K+ и K-). Пробы вносят в амплификатор со следующим температурным режимом:

–  –  –

Пример 4. Детекция продуктов амплификации.

Детекция продуктов амплификации проводится методом электрофореза в 2% агарозном геле, содержащем бромистый этидий.

Исследуется аликвота (7 мкл водной фазы амплификационной смеси).

Электрофорез проводят при напряжении 8 вольт/см длины геля, в течение 60 мин. За это время продукт реакции успевает пройти не менее половины геля. Рекомендуемый размер геля 5-10 см. Направление движения образцов в геле от "-" к "+".

Результаты электрофореза просматривают в ультрафиолетовом свете с длиной волны 254 нм на приборе "Трансиллюминатор". Результаты реакции выявляются в виде светящихся красноватых полос.

Положительными считают пробы, полосы в которых располагаются в геле на уровне полосы положительного контроля.

Исследуемые пробы считают отрицательными, если в них не выявлено никаких полос или полосы не соответствуют по размеру фрагменту в контрольной пробе (т.е. располагаются на другом расстоянии от старта).

В отрицательном контроле не должно выявляться никаких полос. Присутствие в отрицательном контроле окрашенных фрагментов на уровне полос положительного контроля свидетельствует о перекрестной контаминации в процессе анализа. Результаты аннулируются. Анализ необходимо провести заново.

Предлагаемый одностадийный способ обнаружения вируса гриппа А является высокочувствительным к вирусу гриппа А подтипа H5N1 и может быть использован для экспресс-идентификации. Проводится как в двух ПЦР, так и в мультиплексной ПЦР.

Мультиплексная ПЦР позволяет сократить процент финансовых затрат и количество технологических ошибок.

ЛИТЕРАТУРА

1. Breslauer et al // Proc. Natl. Acad. Sci USA. - 1986. - V.83. - P.3746.

2. Brown I.E., Harris P.A., Alexander D.J. Serological studies of influenza virus in pigs in Great Britain 1991-2 // Epidemiol. Infect. - 1995. - Vol.114. - P.511-520.



Pages:     | 1 |   ...   | 2 | 3 || 5 |
 

Похожие работы:

«Брит Владислав Иванович «Эффективность методов вакцинации против ньюкаслской болезни в промышленном птицеводстве» Специальность: 06.02.02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология ДИССЕРТАЦИЯ на соискание ученой степени кандидат ветеринарных наук Научный руководитель:...»

«Шумилова Анна Алексеевна ПОТЕНЦИАЛ БИОРАЗРУШАЕМЫХ ПОЛИГИДРОКСИАЛКАНОАТОВ В КАЧЕСТВЕ КОСТНОПЛАСТИЧЕСКИХ МАТЕРИАЛОВ Специальность 03.01.06 – биотехнология (в том числе бионанотехнологии) ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук Шишацкая Екатерина Игоревна Красноярск...»

«Иртегова Елена Юрьевна РОЛЬ ДИСФУНКЦИИ СОСУДИСТОГО ЭНДОТЕЛИЯ И РЕГИОНАРНОГО ГЛАЗНОГО КРОВОТОКА В РАЗВИТИИ ГЛАУКОМНОЙ ОПТИЧЕСКОЙ НЕЙРОПАТИИ 14.01.07 – глазные болезни ДИССЕРТАЦИЯ на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор медицинских наук, профессор...»

«Доронин Максим Игоревич ЭКСПРЕСС-МЕТОДЫ ВЫЯВЛЕНИЯ ВИРУСА ИНФЕКЦИОННОГО НЕКРОЗА ГЕМОПОЭТИЧЕСКОЙ ТКАНИ ЛОСОСЕВЫХ РЫБ 03.02.02 «Вирусология» Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, Мудрак Наталья Станиславовна Владимир 2015 ОГЛАВЛЕНИЕ 1 ВВЕДЕНИЕ 2 ОБЗОР ЛИТЕРАТУРЫ 2.1 Характеристика возбудителя инфекционного...»

«Степина Елена Владимировна ЭКОЛОГО-ФЛОРИСТИЧЕСКАЯ ХАРАКТЕРИСТИКА СТЕПНОЙ РАСТИТЕЛЬНОСТИ ЮГО-ЗАПАДНЫХ РАЙОНОВ САРАТОВСКОЙ ОБЛАСТИ 03.02.08 – экология (биологические науки) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор...»

«Якимова Татьяна Николаевна Эпидемиологический надзор за дифтерией в России в период регистрации единичных случаев заболевания 14.02.02 эпидемиология диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор...»

«_ ТЕМИРОВ Николай Николаевич КОРРЕКЦИЯ АФАКИИ РАЗЛИЧНОГО ГЕНЕЗА МУЛЬТИФОКАЛЬНЫМИ ИНТРАОКУЛЯРНЫМИ ЛИНЗАМИ С АСИММЕТРИЧНОЙ РОТАЦИОННОЙ ОПТИКОЙ Специальность 14.01.07 – «Глазные болезни» ДИССЕРТАЦИЯ на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор медицинских...»

«Цвиркун Ольга Валентиновна ЭПИДЕМИЧЕСКИЙ ПРОЦЕСС КОРИ В РАЗЛИЧНЫЕ ПЕРИОДЫ ВАКЦИНОПРОФИЛАКТИКИ. 14.02.02 – эпидемиология ДИССЕРТАЦИЯ на соискание ученой степени доктора медицинских наук Научный консультант: заслуженный деятель науки РФ, лауреат Государственной премии СССР профессор, доктор медицинских наук Ющенко Галина Васильевна Москва – 20 Содержание...»

«Цховребова Альбина Ирадионовна ВЛИЯНИЕ ФАКТОРОВ СРЕДЫ НА РАЗВИТИЕ БЕСХВОСТЫХ АМФИБИЙ СЕВЕРНЫХ СКЛОНОВ ЦЕНТРАЛЬНОГО КАВКАЗА Специальность 03.02.14 – биологические ресурсы Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель доктор биологических наук профессор Калабеков Артур Лазаревич Владикавказ 2015 Содержание Ведение..3 Глава I. Обзор литературных данных. 1.1....»

«Будилова Елена Вениаминовна Эволюция жизненного цикла человека: анализ глобальных данных и моделирование 03.02.08 – Экология Диссертация на соискание ученой степени доктора биологических наук Научный консультант доктор биологических наук, профессор А.Т. Терехин Москва 2015 Посвящается моим родителям, детям и мужу с любовью. Содержание Введение.. 5 1. Теория эволюции жизненного цикла. 19...»

«ДОРОНИН Игорь Владимирович Cистематика, филогения и распространение скальных ящериц надвидовых комплексов Darevskia (praticola), Darevskia (caucasica) и Darevskia (saxicola) 03.02.04 – зоология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, заслуженный эколог РФ Б.С. Туниев Санкт-Петербург Оглавление Стр....»

«Смешливая Наталья Владимировна ЭКОЛОГО-ФИЗИОЛОГИЧЕСКИЕ АСПЕКТЫ РЕПРОДУКТИВНОЙ ФУНКЦИИ СИГОВЫХ РЫБ ОБЬ-ИРТЫШСКОГО БАССЕЙНА 03.02.06 Ихтиология Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель кандидат биологических наук, доцент Семенченко С.М. Тюмень – 2015 ОГЛАВЛЕНИЕ...»

«Сафранкова Екатерина Алексеевна КОМПЛЕКСНАЯ ЛИХЕНОИНДИКАЦИЯ ОБЩЕГО СОСТОЯНИЯ АТМОСФЕРЫ УРБОЭКОСИСТЕМ Специальность 03.02.08 – экология (биологические науки) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор...»

«Кириллин Егор Владимирович ЭКОЛОГИЯ ОВЦЕБЫКА (OVIBOS MOSCHATUS ZIMMERMANN, 1780) В ТУНДРОВОЙ ЗОНЕ ЯКУТИИ 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: д. б. н., профессор Мордосов И. И. Якутск – 2015 Содержание Введение.. Глава 1. Краткая физико-географическая...»

«Хохлова Светлана Викторовна ИНДИВИДУАЛИЗАЦИЯ ЛЕЧЕНИЯ БОЛЬНЫХ РАКОМ ЯИЧНИКОВ 14.01.12-онкология ДИССЕРТАЦИЯ На соискание ученой степени доктора медицинских наук Научный консультант: Доктор медицинских наук, профессор Горбунова В.А Москва 2015 ОГЛАВЛЕНИЕ Введение Глава 1. Обзор литературы 1.1. Общая характеристика рака яичников 1.1.1. Молекулярно-биологические и...»

«Якимова Татьяна Николаевна Эпидемиологический надзор за дифтерией в России в период регистрации единичных случаев заболевания 14.02.02 эпидемиология диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор...»

«Мухаммед Тауфик Ахмед Каид ХАРАКТЕРИСТИКА ГЕНОТИПОВ С ХОРОШИМ КАЧЕСТВОМ КЛЕЙКОВИНЫ, ОТОБРАННЫХ ИЗ ГИБРИДНЫХ ПОПУЛЯЦИЙ АЛЛОЦИТОПЛАЗМАТИЧЕСКОЙ ЯРОВОЙ ПШЕНИЦЫ МЯГКОЙ С ИСПОЛЬЗОВАНИЕМ ДНК-МАРКЕРОВ Специальность 06.01.05 – селекция и семеноводство сельскохозяйственных растений Диссертация на соискание ученой степени кандидата сельскохозяйственных наук Научный...»

«АБДУЛЛАЕВ Ренат Абдуллаевич ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ МЕСТНЫХ ФОРМ ЯЧМЕНЯ ИЗ ДАГЕСТАНА ПО АДАПТИВНО ВАЖНЫМ ПРИЗНАКАМ Шифр и наименование специальности 03.02.07 – генетика 06.01.05 – селекция и семеноводство сельскохозяйственных растений ДИССЕРТАЦИЯ на соискание учёной степени кандидата...»

«Ульянова Онега Владимировна МЕТОДОЛОГИЯ ПОВЫШЕНИЯ БЕЗОПАСНОСТИ БАКТЕРИАЛЬНЫХ ВАКЦИН НА МОДЕЛИ ВАКЦИННЫХ ШТАММОВ BRUCELLA ABORTUS 19 BA, FRANCISELLA TULARENSIS 15 НИИЭГ, YERSINIA PESTIS EV НИИЭГ 03.02.03 – микробиология Диссертация на соискание ученой степени доктора биологических наук Научный консультант:...»

«СИДОРОВА ТАТЬЯНА АЛЕКСАНДРОВНА ОСОБЕННОСТИ АДАПТИВНЫХ РЕАКЦИЙ У ДЕВУШЕК К УСЛОВИЯМ ГОРОДСКОЙ СРЕДЫ 03.02.08 Экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, доцент Драгич О.А. Омск-2015 СОДЕРЖАНИЕ Введение.. Глава 1 Обзор литературы.. 1.1. Механизмы адаптации организма человека к окружающей среде 1.2. Закономерности развития...»







 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.