WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 


Pages:     | 1 || 3 | 4 |   ...   | 5 |

«ЭКСПРЕСС-МЕТОДЫ ВЫЯВЛЕНИЯ ВИРУСА ИНФЕКЦИОННОГО НЕКРОЗА ГЕМОПОЭТИЧЕСКОЙ ТКАНИ ЛОСОСЕВЫХ РЫБ ...»

-- [ Страница 2 ] --

При этом метод достаточно чувствительный и специфичный, что позволяет получать достоверные результаты при диагностике заболеваний [118]. По своей диагностической чувствительности РАЛ значительно превышает иммунодиффузные тесты, реакцию преципитации в геле и встречный иммуноэлектрофорез, не уступает реакции пассивной гемагглютинации и при использовании специальных анализаторов для учета степени агглютинации может конкурировать с иммуноферментным анализом [6]. В отличие от иммунохроматографического метода, своего конкурента по быстроте выполнения анализа, изготовление латексных препаратов технологически значительно проще, быстрее и экономически менее затратное. Латексные диагностикумы хорошо работают с поликлональными антителами, и для их изготовления требуется один вид антител или антигена, тогда как для иммунохроматографических тестов требуется, как правило, несколько видов моноклональных антител [60].

Основным недостатком РАЛ является вероятность возникновения спонтанной агглютинации, которая может наблюдаться при наличии в исследуемых биологических жидкостях посторонних белков или при длительном хранении в нестандартных условиях [38, 94, 118]. Количество ложноположительных результатов минимизируют благодаря приготовлению серии разведений исследуемого образца, ферментативной обработки протеазами.

Однако эти манипуляции могут снизить чувствительность латексных препаратов [119]. Также для снижения вероятности спонтанной агглютинации, вызванной формированием цепей или мостиков из микросфер, открытые сайты связывания на поверхности частиц блокируют неспецифическим белком (бычий сывороточный альбумин (BSA), белки неиммунной сыворотки лошади и др.).

Различают простую и сложную адсорбцию биолиганда. Простая адсорбция представляет собой присоединение белка к гидрофобной поверхности частиц за счет Ван-дер-Ваальсовых сил притяжения, а также ковалентное связывание без участия модификаторов и дополнительных «сшивок». Для проведения сложной адсорбции биолиганда используют промежуточные компоненты, обеспечивающие связывание латексной частицы с необходимым белком (модификаторы, белок A, G, гаптены и др.). Присоединение биологических молекул к поверхности латекса достигается благодаря физической адсорбции и ковалентного связывания, которые в сумме составляют общую адсорбцию [47].

Глобулярные белки обладают высокой Физическая адсорбция.

способностью адсорбироваться на поверхности полимера за счет физических явлений. В 1978 г. Norde W. и Liklema J. разработали теорию коллоидной стабильности, в соответствии с которой степень физической адсорбции IgG зависит от баланса Ван-дер-Ваальсовых сил притяжения и электростатических сил отталкивания [119]. В процессе физической адсорбции белка на гидрофобной поверхности полимера образуются комплексы «белок-адсорбент», «белок-белок».

Процесс адсорбции этих молекул на поверхности полистирольных частиц зависит от различных факторов. Зависимость степени адсорбции белка от его концентрации отражается графиком изотермы адсорбции, уровень наклона которой является мерой физической адсорбции белка. При увеличении концентрации иммуноглобулинов G возрастает степень адсорбции, достигая при определенном количестве уровня плато, при котором степень сенсибилизации латекса наибольшая [119].

Степень адсорбции белка также зависит от показателя кислотности буферного раствора, в котором находятся частицы латекса. Зависимость этих величин отражается в виде параболического графика, наивысшая точка которого соответствует плато адсорбции [32]. Максимальные значения степени адсорбции белка достигаются вблизи его изоэлектрической точки. При удалении значений рН от изоэлектрической точки повышаются силы электростатического отталкивания белковых молекул, в результате чего уменьшается количество иммуноглобулина, адсорбирующегося на поверхности полимера [119].

Степень физической адсорбции белка определяется также ионной силы (I) буферного раствора. При увеличении ионной силы ослабевают силы электростатического взаимодействия между молекулами адсорбата и адсорбента, в результате этого снижается количество адсорбированного белка и практически исчезает параболическая зависимость степени адсорбции иммуноглобулина от рН [47, 119].

Таким образом, степень физической адсорбции белка зависит от его концентрации, ионной силы и показателя кислотности буферного раствора, в котором находятся латексные частицы. Физическая адсорбция возможна благодаря формированию гидрофобных, кулоновских и водородных связей между белком и поверхностью микросфер.

Химическая адсорбция. Сенсибилизация латексных частиц биолигандом возможна не только в процессе физической адсорбции, но и благодаря ковалентному связыванию [119]. Химическая адсорбция имеет ряд преимуществ по сравнению с физическим связыванием. При ковалентном присоединении в большей степени сохраняется правильная пространственная организация белка, благодаря чему биологическая активность латексных препаратов выше.

Химическая адсорбция позволяет снижать вероятность спонтанной агглютинации, так как все ионогенные группы латексов взаимодействуют с функциональными группами белка. В процессе физической адсорбции между белком и гидрофобной поверхностью латекса формируются слабые Ван-дер-Ваальсовые взаимодействия, что обуславливает склонность комплекса «латекс-белок» к десорбции. При химической адсорбции устанавливаются более сильные ковалентные связи, снижая вероятность десорбции. Считается, что латексные препараты, полученные благодаря ковалентному связыванию белка, характеризуются более высокой степенью адсорбции и имеют продолжительный срок хранения [74, 131, 150, 156].

Таким образом, по сравнению с физической адсорбцией ковалентное присоединение биолиганда к твердофазному носителю надежнее за счет более высокой специфической адсорбции, что позволяет повысить чувствительность и специфичность латексных препаратов. Химическая адсорбция является сложной, т.к. предусматривает применение широкого спектра химических «сшивок» [71, 82].

–  –  –

группы белка и микросфер с образованием основания Шиффа. Это альдегидный тип связывания, при котором отмечается хорошая воспроизводимость данной реакции, но при этом имеется ряд недостатков: в обычных условия может происходить окисление и полимеризация альдегидной группы; основания Шиффа не являются стабильными соединениями, что может вызывать побочные реакции [71].

3. Связывание по –ОН группе латексных частиц и –NH2 группе белка.

Процесс химической адсорбции белка на поверхности гидроксилированных латексов осуществляется с использованием цианобромида. Реакцию рекомендуется проводить в среде со щелочной реакцией, которая препятствует протонированию –NH2 группы и способствует образованию комплекса «латекс– O–C(NH2)–NH–белок». Недостатком данного метода является опасность работы с цианобромидом, применяемым в качестве модификатора, и побочными продуктами реакции [118].

4. Связывание по –SH группам латексных частиц и белка. Катионы тяжелых металлов с валентностью II (ртути, меди, свинца и других металлов) интенсивно реагируют с меркаптогруппами белка и латексов по типу нуклеофильного замещения, образуя металлоорганические латексные препараты состава «латекс–S–Me–S–белок». Однако при этом высока вероятность образования ионных связей между катионом металла и –SH группами латексных частиц, что может снизить степень адсорбции биолиганда [83].

Для увеличения степени и силы адсорбции белка на поверхности латекса применяют различные компоненты, необходимые для «сшивания» частицы и биолиганда. Так, повысить адсорбционную способность латексов возможно, применяя белок A, который адсорбируется на поверхности микросфер и связывает Fc-фрагменты различных антител. За счет этого происходит присоединение IgG с ориентацией его Fab-фрагментов наружу, что позволяет получать латексные препараты с лучшими диагностическими показателями [119].

Таким образом, по сравнению с физической адсорбцией ковалентное присоединение белка к поверхности латекса является более сложным многоступенчатым процессом. За счет использования широкого спектра функциональных групп и модификаторов существует множество вариантов химического связывания белковых молекул. Для каждого из них следует подбирать оптимальные условия адсорбции, которые позволяют повышать степень связывания белка и улучшать диагностические характеристики латексных препаратов.

Коллоидная стабильность латексных препаратов. Одним из основных требований, предъявляемых к латексным диагностикумам, является их коллоидная стабильность [46, 47, 119]. Под устойчивостью латексных препаратов понимают способность суспензии сохранять определенную степень дисперсности и равномерное распределение частиц по объему буферного раствора без агрегации и осаждения [46, 148].

Серьезной проблемой в использовании латексных диагностикумов является вероятность снижения коллоидной стабильности комплекса «латекс-белок» при хранении, что может привести к возникновению спонтанной агглютинации и получению ложноположительных результатов [127]. Поэтому вопросы регулирования устойчивости латексных диагностикумов имеет большое прикладное значение.

Склонность латексных микросфер к агрегации отражается значением коллоидной дисперсии (G), которая прямо пропорциональна межфазному поверхностному натяжению () и свободной энергии системы (Е). По стабильности латексные препараты делят на агрегативно устойчивые и неустойчивые. Если G0, то система лиофильная, термодинамически устойчивая и не характеризуются стремлением дисперсной фазы к агрегации. При G0 система является агрегативно неустойчивой, лиофобной и обладает избыточной поверхностной энергией. В лиофобных системах протекают процессы самопроизвольного укрупнения частиц, сопровождающиеся понижением общей энергии системы в результате уменьшения удельной поверхности [47].

Стремление латексных частиц к агрегации объясняется теорией коллоидной стабильности Дерягина-Ландау-Фервея-Овербека (ДЛФО), согласно которой устойчивость системы в полярной среде определяется балансом Ван-дерВаальсовых сил притяжения и электростатических сил отталкивания.

Следовательно, существование латексных частиц в электростатически стабильном состоянии возможно, когда силы отталкивания превосходят Ван-дер-Ваальсовые взаимодействия при наличии заряда на поверхности микросфер [47]. В соответствии с теорией ДЛФО, коллоидная стабильность латексов зависит от действия различных факторов. На стремление системы к агрегации влияет расстояние между микросферами латекса. Силы молекулярного притяжения частиц уменьшаются с расстоянием по степенному закону, а силы электростатического отталкивания – по экспоненте. В результате этого на дальних и малых расстояниях между частицами латекса преобладают силы притяжения, а на средних – силы отталкивания. Таким образом, вероятность агрегации минимальна при нахождении латексных частиц на средних расстояниях между собой. Для каждой лиофобной системы характерно существование энергетического барьера (Е), который препятствует агрегации частиц. При сближении микросфер, обладающих кинетической энергией, достаточной для преодоления этого барьера, происходит коагуляция латексов и дестабилизация латексной суспензии [115].

Коллоидная стабильность латексов также зависит от концентрации электролитов раствора, в котором находятся микросферы. Введение электролитов в систему вызывает снижение высоты энергетического барьера и возникновение электролитной коагуляции. С увеличением ионной силы происходит снижение энергетического барьера, полностью исчезающего при достижении критической концентрации коагуляции, минимальной концентрации электролита, при которой подавляются силы электростатического отталкивания, и наступает агрегация частиц латексной суспензии [117]. Дальнейший рост ионной силы приводит к увеличению коллоидной стабильности латексных суспензий. С точки зрения теории ДЛФО, данное явление аномально и объясняется существованием гидратных сил. Молекулы воды и гидратированные катионы связываются с гидрофильными участками комплекса «латекс-белок», что способствует отталкиванию микросфер друг от друга. Гидратные силы зависят от типа и концентрации электролитов, присутствующих в растворе [69].

С целью получения устойчивых коллоидных систем латексных препаратов важно создавать условия для достижения заданной дисперсности и её стабилизации. Для решения этой проблемы применяют следующие методы.

1. Блокирование сайтов неспецифического связывания с помощью белка (бычьего сывороточного альбумина (BSA), казеина, сывороточного альбумина и др.) [118]. Преимущественно используют BSA, проводя последовательную адсорбцию белковых компонентов или коадсорбцию [146]. Коадсорбция по сравнению с последовательной адсорбцией представляет собой более сложный процесс, поскольку в системе находятся сразу два разных белка. Peula, J.M., Puig, J. et al. (1994) отмечают, что при совместной адсорбции необходимо проводить поиск оптимального соотношения между количеством IgG, ответственного за проявление биологической активности латексного препарата, и концентрацией белка, используемого для блокирования сайтов неспецифического связывания и снижения вероятности спонтанной агглютинации [131].

2. Введение в лиофобную систему стабилизаторов, способных адсорбироваться на границе раздела фаз, приводит к снижению избыточной энергии системы и повышению ее коллоидной стабильности [47]. В качестве стабилизаторов латексных суспензий применяют растворы поверхностноактивных веществ (ПАВ), увеличивающих силы электростатического отталкивания частиц и препятствующих агрегации латексов. При этом важно осуществлять поиск оптимальной концентрации стабилизатора, поскольку избыточное количество ПАВ может ингибировать специфическое взаимодействие антигена и антитела и вызывать десорбцию белка, связанного с гидрофобной поверхностью латекса за счет Ван-дер-Ваальсовых взаимодействий [69, 127].

3. Elgersma et al. (1992) предлагают повышать устойчивость латексных суспензий за счет блокирования сайтов неспецифического связывания моноклональными антителами со значениями изоэлектрической точки, находящимися вдали от физиологического рН. Коллоидная стабильность таких дисперсных систем высокая, однако применение моноклональных антител значительно увеличивает стоимость синтезируемой латексной тест-системы [118].

4. С целью повышения коллоидной стабильности и аналитической чувствительности латексных препаратов Lievens, Buijs, Ortega-Vinuesa, Borgue et al. (2001) в качестве антигенсвязывающего компонента предлагают использовать не целую молекулу иммуноглобулина G, а ее Fab–фрагменты. Применение Fabфрагментов исключает вероятность получения ложноположительных результатов при исследовании проб патологического материала с помощью РАЛ [119, 127, 158].

2.6 Заключение по обзору литературы ИНГТ – высококонтагиозное вирусное заболевание, которое встречается как среди свободно обитающих лососевых рыб, так и выведенных в рыбопитомниках.

Входит в перечень болезней, обязательно декларируемых в Международной организации здравоохранения животных (OIE). Приказом Министерства сельского хозяйства РФ данная вирусная инфекция отнесена к заразным и особоопасным заболеваниям рыб, предполагающим наложение карантина. ИНГТ наносит значительный экономический ущерб, который складывается из затрат на проведение карантинных мероприятий, уничтожения всей рыбы на территории очага болезни и ограничений в торговле.

С целью сохранения продовольственной безопасности страны в области рыболовства, а также биоразнообразия рыб в природе проводится масштабный контроль ИНГТ аквакультуры, важным звеном которого является эпизоотологический мониторинг. По руководству OIE, лабораторная диагностика ИНГТ предполагает постановку биопробы на рыбе, выделение вируса в культуре клеток, а также проведение ИФА, РИФ и ОТ-ПЦР.

В настоящее время проводить лабораторную диагностику ИНГТ с использованием классических методов имеют возможность лишь крупные научно-исследовательские учреждения, так как их применение предполагает закупку дорогостоящих коммерческих наборов и оборудования для проведения анализа. Поэтому актуальной задачей является разработка экспресс-методов выявления вируса ИНГТ как в лабораторных условиях, так и непосредственно в рыбоводческих хозяйствах. Достаточной чувствительностью и специфичностью, а также простотой выполнения анализа характеризуется бесприборный экспрессметод РАЛ для выявления вируса ИНГТ, который может найти свое применение в лабораториях хозяйств с разной степенью приборной оснащенности.

С точки зрения экспрессности, а также высокой чувствительности актуальной является разработка метода ОТ-ПЦР-РВ в формате диагностических ПЦР-чипов, позволяющего исследовать патматериал рыб одновременно на несколько инфекционных заболеваний. Таким образом, разработка экспресс-методов диагностики ИНГТ лососевых рыб для дополнения существующей схемы является актуальной задачей.

–  –  –

мг/мл); 4% раствор сульфата гентамицина (ЗАО НПП «Агроферм», г. Воронеж);

фосфатный, трис-НCl, Hepes- буферные растворы; насыщенный раствор сульфата аммония; диспергирующий растворов трипсина (0,25%) и версена (0,02%); Lглутамин («ПанЭко», г. Москва); 25 мМ раствор MgCl2 («Promega», США); 10 мМ раствор дезоксинуклеозидтрифосфатов («Fermentas», Литва); 10х буферный раствор для Taq-полимеразы; РНК-зависимая ДНК-полимераза («Promega», США); HS Taq-полимераза (5 ед/мкл) («Promega», США); полный и неполный адъювант Фрейнда («Sigma»); пристан («Biomedicals», Франция); полиакриламид («Amersco», США); (2-оксиэтил)-триметиламмония хлорид («Serva», Германия);

лаурилсульфат натрия (ООО «РусХимТрейд»).

Наборы реактивов. В работе использовали набор реактивов «РИБО-сорб вариант 100» ФБУН ЦНИИ эпидемиологии Роспотребнадзора, набор реагентов для обнаружения вируса ИНГТ в сэндвич-варианте ИФА «TEST-LINE» (Чехия).

Праймеры и зонды. Праймеры и зонды, предназначенные для выявления вирусов ИНГТ, ВГС и ВВК, синтезированы на предприятии «Амплипрайм», их структура представлена в таблице 2.

Таблица 2 - Структура праймеров и зондов для выявления вирусов ИНГТ, ВГС и ВВК в ОТ-ПЦР-РВ с применением диагностических ПЦР-чипов Название Структура олигонуклеотида Длина ПЦРпродукта

IHN-F AGACTGATGAGGATCGTAGCA 67

IHN-R CGCCATCGTACTTGAGGACA

IHN-P FAM/ROX-ACGAGAACGCCAGGATCACCT-BHQ1

VHS-F TGCATTCAYCCTGACCGAAGA 66

VHS-R GATCCGTCTGGCTGAAGAAAT

VHS-P FAM/ROX-AGCAGTACGGCACGATCTCAG-BHQ1

SVC-F GAGGCTTCACTGGTGAGT 103

SVC-R ACTCGTACAGTAGGCATCCAA

SVC-P FAM/ROX-TTAGCCGAAСAATCGATCTGT-BHQ1

Примечание: F – прямой праймер, R – обратный праймер, P – зонд Для выбора систем праймеров использовали программу Oligo 6. Зонды, меченые красителем FAM, применяли для выявления специфических фрагментов вирусов ИНГТ, ВГС и ВВК. Олигонуклеотиды, меченые красителем ROX, использовали для внутреннего контрольного образца (ВКО) и положительных контролей. Дизайн праймеров и зондов предложен ООО «Люмэкс-Маркетинг».

Диагностические специфические препараты. В работе использовали поликлональные антитела против иммуноглобулинов кролика и мыши, меченные пероксидазой (рабочее разведение 1:3000) (ГУ НИИЭМ им. Н.Ф. Гамалеи, г.

Москва); моноклональные антитела диагностические против антигенов вируса ИНГТ (получены совместно с ГУ НИИЭМ им. Н.Ф. Гамалеи, г. Москва).

Латексные суспензии. В работе применяли полистирольные латексные частицы белого цвета производства ООО «Диафарм» (г. Санкт-Петербург) с

-COOH, -NH2, -SO4 группами, с концентрацией поверхностных функциональных групп 1,42, 1,70 и 1,98 мкг-экв/м2, диаметрами микросфер 950, 740, 650, 340 нм.

Использовали также латексы белого цвета с диаметром частиц 250, 110, 90 нм и концентрацией выше указанных групп 1,98 мкг-экв/м2.

Дополнительный компонент для связывания антител с поверхностью латекса. Для присоединения антител к поверхности латексных частиц применяли стрептококковый белок А («Акохим», Россия) (таблица 3).

Таблица 3 - Компоненты для адсорбции антител против вируса ИНГТ на поверхности латексов

–  –  –

Компонент для химической «сшивки». Для химической адсорбции белка по концевым -NH2 группам лизина и по - NH2 группам на поверхности латексных частиц использовали в качестве модификатора 25% водный раствор глутарового альдегида («Serva», Германия) (таблица 3).

Диагностические ПЦР-чипы. Для проведения ОТ-ПЦР-РВ использовали кремниевые диагностические ПЦР-чипы, содержащие 30 микрореакторов (рис. 6) (ООО «Люмэкс-Маркетинг», г. С.-Петербург).

Рисунок 6 – Диагностический ПЦР-чип с лиофилизированной тест-системой для проведения ОТ-ПЦР-РВ В процессе выполнения работы было использовано Оборудование.

следующее оборудование:

- ламинар с вертикальным рециркуляционным потоком (ООО «Импеданс», Россия); ПЦР-бокс с встроенным ультрафиолетовым облучателем (ООО «Импеданс», Россия); холодильник бытовой («Indesit», Италия); низкотемпературный холодильник («Sanyo», Япония); термостат суховоздушный «ТС-80» (Россия); термостат для пробирок с температурой нагрева до 96°С («Eppendorf», Германия); ультрацентрифуга «Sorvall OTD 65B»

(США); центрифуга «MISTRAL 6L» (Великобритания); настольная центрифуга («Eppendorf», Германия); инвертированный микроскоп («Nikon», Япония);

микрочиповый амплификатор нуклеиновых кислот в режиме реального времени «АриаДНА» («Люмэкс-Маркетинг», Россия); pH метр «pH-121» (Россия); вошер «BioRad PW 40» (Франция); ридер «BioRad PR 2100» (США); весы аналитические «OHAUS» (Швейцария); пипеточные дозаторы полуавтоматические с переменным объемом на 10, 100, 200, 1000 мкл («Gilson»); вакуумный насос («Millipore», Франция); вортекс для пробирок 1,5 мл («Eppendorf», Германия);

источник тока для электрофореза («Bio-Rad», США); видеосистема для документирования результатов электрофореза GelDoc («Bio-Rad», США).

Отбор проб патологического материала проводили в соотвествии с «Методическими указаниями по отбору проб патологического материала от рыб»

[27].

Вирусвыделение из патологического материала рыб в культуре клеток, реакцию агглютинации латекса и ОТ-ПЦР-РВ с использованием диагностических ПЦР-чипов для выявления вируса ИНГТ проводили в соответствии с методическими рекомендациями, разработанными в ФГБУ «ВНИИЗЖ» (см. Приложения 1, 2, 3).

Сэндвич-вариант ИФА для выявления вируса ИНГТ проводили в соответствии с инструкцией производителя коммерческого набора реагентов («TEST-LINE», Чехия).

Приготовление очищенного концентрированного антигена вируса ИНГТ. Проводили методом, описанным Апасовой Л.Ю. [33]. В работе использовали суспензию культурального вируса ИНГТ (штамм «Аркус 32/87»), полученную путем репродукции вируса в перевиваемой культуре клеток RTG-2.

Концентрацию белка в полученных препаратах вируса ИНГТ определяли по методу Лоури [112]. Степень чистоты контролировали методом вертикального электрофореза в полиакриламидном геле с додецилсульфатом натрия (SDS-ПААГ) в денатурирующих условиях [33]. Определение стерильности вирусного материала проводили в соответствии с ГОСТ 28085-89 «Препараты биологические. Методы биологического контроля на стерильность».

Получение поликлональных антител к вирусу ИНГТ. Для получения поликлональных антител к вирусу ИНГТ использовали очищенный антиген, которым иммунизировали кроликов. Вирус вводили животным внутримышечно три раза по схеме – 1, 40, 54 дни, в дозе 400 мкг на голову кролика.

При иммунизации кроликов первую инъекцию проводили с полным адъювантом Фрейнда (ПАФ), а последующие - с неполным адъювантом Фрейнда (НАФ). Через две недели после последней инъекции в сыворотках крови иммунизированных животных определяли титры специфических антител методом ТФ непрямого варианта ИФА. В дальнейшей работе использовали сыворотки крови с титрами антител к вирусу ИНГТ не ниже 1:64000. Из отобранных сывороток выделяли фракцию IgG методом высаливания сульфатом аммония.

Антитела хранили в смеси с глицерином в соотношении 1:1 и с добавлением 0,01% азида натрия при температуре минус 20С. Концентрацию белка определяли методом спектрофотомерии при длине волны 280 нм. В работе использовали суспензии с концентрациями поликлональных антител к вирусу ИНГТ не ниже 20 мг/мл и активность в ТФ непрямом варианте ИФА 1:256000 и выше.

Получение гибридом. Работу по получению гибридом и моноклональных антител к антигенам вируса ИНГТ проводили совместно с научными сотрудниками ФГБУН ИБХ им. М.М. Шемякина и Ю.А. Овчинникова РАН (г.

Москва). Для этого мышей линии BALB/c иммунизировали подкожно в подушечки задних лапок вирусом ИНГТ в дозе 15 мкг/мышь в присутствии НАФ 3 раза с интервалом 2 недели. Через 14 суток после последней иммунизации мышам вводили вирус ИНГТ в физиологическом растворе в тех же дозах. Спустя 6 суток у мышей отбирали селезенку, которую измельчали и готовили суспензию в культуральной среде Игла DМЕМ. Выделенные лимфоциты использовали для гибридизации с клетками миеломы SP 2/0 по методу Колера и Мильштейна [99].

Наращивание клеток миеломы для гибридизации и процесс слияния клеток проводили в среде Игла DMEM, содержащей 10% фетальной сыворотки крови

КРС. Гибридизацию клеток миеломы и лимфоцитов проводили в соотношении 3:1

в присутствии 50% ПЭГ (м.в. 6000) и 10% хлорида кальция и инкубировали 30 минут при 37°С. После гибридизации клетки вносили в лунки иммунологического планшета. Клетки культивировали в ростовой среде Игла DMEM с добавлением 0,1 мМ гипоксантина, 1,6 х 10-5 М тимидина, 4 х 10-7 М аминоптерина. Спустя 7-10 суток после гибридизации определяли антителообразующую активность полученных гибридом. Для этого из лунок, в которых наблюдался активный рост клеток, отбирали культуральную среду и тестировали ее методом ТФ непрямого варианта ИФА на наличие антител к вирусу ИНГТ. Из лунок, в культуральной среде которых регистрировали достоверно положительную реакцию с вирусом ИНГТ, отбирали клетки и клонировали их трехкратно методом предельных разведений в ростовой среде.

Для дальнейшей работы отбирали гибридомы, уровень активности которых превышал контрольное значение в 15-20 раз.

Получение моноклональных антител к вирусу ИНГТ. Для получения асцитной жидкости в брюшную мыши вводили гибридому, через 3 недели получали асцитную жидкость, из которой выделяли фракцию моноклональных антител методом высаливания сульфатом аммония. Антитела хранили в смеси с глицерином в соотношении 1:1 и с добавлением 0,01% азида натрия при минус 20С. Концентрацию антител определяли методом спектрофотометрии при длине волны 280 нм и в ТФ непрямом варианте ИФА. В работе по синтезу латексных препаратов использовали моноклональные антитела №4 и 15, специфичные к эпитопам N-, G-белка вируса ИНГТ с концентрациями 28,1 и 54,6 мг/мл, активностью в ТФ непрямом варианте ИФА 1:192000 и 1:384000, соответственно.

Электрофорез и иммуноблоттинг. Электрофорез образцов вируса ИНГТ и моноклональных антител в восстанавливающих условиях проводили в 12,5% SDS-ПААГ по методу Лэммли [106]. Белки вируса ИНГТ вместе с полоской геля переносили на нитроцеллюлозную мембрану ВА-85. Мембрану накладывали поверх геля, сверху помещали стопку фильтровальной бумаги. Всю стопку помещали в буферный раствор, который продвигался вверх по бумаге под действием капиллярных сил, унося с собой белки. Эффективность переноса белков из геля на мембрану проверяли окрашиванием мембраны 0,125% раствором красителя Coomassie blue R-250. Неспецифическое связывание на репликах блокировали обработкой их 1% бычьим сывороточным альбумином (BSA) в трис-солевом буферном растворе (TBS) с добавлением 0,1% Tween-20.

После блокирования проводили инкубирование моноклональных антител (5 мкг/мл) с мембраной в течение ночи при комнатной температуре. После промывания мембраны для удаления несвязавшихся антител, ее выдерживали в меченых пероксидазой хрена антителах к мышиным иммуноглобулинам (рабочее разведение 1:3000). В качестве хроматогена использовали смесь 4-хлорнафтола с 1% перекисью водорода.

Определение активности сывороток и асцитных жидкостей к антигенам вируса ИНГТ. Для определения активности гипериммунных сывороток кролика или асцитных жидкостей 96-луночный микропланшет сенсибилизировали очищенным антигеном вируса ИНГТ с концентрацией 1 мкг/мл, открытые центры связывания блокировали 1% BSA на растворе TBS, затем вносили испытуемые ИНГТ-специфичные и контрольные сыворотки в различных разведениях и антивидовые антитела, меченые пероксидазой хрена (рабочее разведение 1:3000). Разведения испытуемых сывороток и конъюгата готовили на растворе TBST. Инкубацию с реагентами проводили в течение 1 ч при 37°С. В качестве хроматогена использовали тетраметилбензидин (TMB).

Реакцию останавливали 3М серной кислотой и измеряли значения оптической плотности на спектрофотометре-ридере при длине волны 450 нм. Максимальное разведение сыворотки, которое превышало ОП отрицательного контроля в 2,1 раза, принимали за предельное разведение.

Определение концентрации антител к антигенам вируса ИНГТ в ИФА.

Анализ проводили, как при определении активности сывороток и асцитных жидкостей. При этом в качестве положительного контроля использовали сыворотку кролика с концентрацией антител к вирусу ИНГТ 2 мг/мл в разведении 1:800 в растворе TBS. В качестве отрицательного контроля применяли раствор TBS. Для построения калибровочной кривой использовали сыворотку с концентрацией специфичных антител 2 мг/мл, которую разводили 1:100 и титровали с двукратным шагом в вертикальных рядах в двух повторах.

Исследуемые пробы, содержащие антитела к вирусу ИНГТ, разводили 1:100 и вносили в двух повторах. Концентрацию антител к вирусу ИНГТ в исследуемых пробах, выраженную в мг/мл, определяли с использованием калибровочной кривой и компьютерной программы Microsoft Excel 2010.

В работе использовали Синтез латексных диагностикумов.

высокостабильные латексные суспензии, в которых отсутствовали конгломераты.

Оценку гранулометрического состава проводили с помощью световой микроскопии. Латексные препараты для выявления вируса ИНГТ готовили по следующей схеме. Суспензии латекса выдерживали при комнатной температуре в течение 30 мин. Частицы отмывали от раствора сурфактанта, в котором они хранились. Для этого от каждой суспензии в центрифужную пробирку отбирали по 0,3 мл и смешивали с 1,2 мл глицин-солевого буферного раствора (ГСБР), после чего центрифугировали при 3000g в течение 15 мин. Супернатант удаляли, осадок ресуспендировали в 1,5 мл ГСБР. Процедуру центрифугирования повторяли 3 раза. Получали препараты со следующими массовыми долями частиц: 0,5; 1; 1,5; 2; 3 %. Для синтеза латексных диагностикумов использовали буферные растворы разного состава (боратный буферный раствор (ББР), фосфатный буферный раствор (ФБР), фосфатно-солевой буферный раствор (ФСБР), глицин-солевой буферный раствор (ГСБР)) с разными значениями ионной силы (0,15, 0,10, 0,05, 0,025, 0,005 ммоль/л) и разными значениями показателя кислотности (рН 4-10).

Латексные частицы сенсибилизировали моноклональными и поликлональными антителами к вирусу ИНГТ с концентрациями 1500, 1000, 750, 500 мкг/мл. В качестве дополнительного компонента, связывающего антитела с поверхностью частиц, применяли 1% стрептококковый белок А в ГСБР. Для хранения сенсибилизированных частиц латекса использовали ГСБР с разными значениями ионной силы: 5, 10, 20, 30, 50, 80, 100, 120, 140, 150, 180, 200, 250, 300 ммоль/л. Для химической адсорбции антител по концевым -NH2 группам лизина и по -NH2 группам на поверхности латексных частиц проводили сенсибилизацию микросфер смесью, содержащей IgG к вирусу ИНГТ и 1% глутаральдегида, пропущенного через нитроцеллюлозный фильтр DURAPORE с диаметром пор 0,45 мкм («Millipore»). Инкубацию латексных частиц с антителами проводили в течение 2 ч при 37°С при частом перемешивании и 18 ч при 4°С, после этого суспензии центрифугировали при 3000g в течение 10 мин. Супернатант сохраняли для определения количества неадсорбированных антител. В качестве буферных растворов для блокирования открытых сайтов связывания использовали следующие глицин-белковые буферные растворы (ГББР): 1) 1%, 5%, 10% BSA в ГСБР; 2) 1%, 5%, 10% неиммунную сыворотку лошади в ГСБР; 3) 0,1%, 0,5%, 1,0% желатин в ГСБР.

Осадок 3 раза отмывали в течение 15 мин ГББР для одновременного удаления неадсорбированных антител и блокирования свободных сайтов связывания на поверхности латексных частиц. Конечный осадок ресуспендировали в 2 мл ГСБР с разными значениями ионной силы (5, 10, 20, 50, 75, 100, 150, 140, 150, 180, 200, 250, 300 ммоль/л) с добавлением 0,01% азида натрия. Полученные латексные препараты хранили при 4оС, периодически перемешивая, и оценивали их коллоидную стабильность в течение полугода с периодичностью 1 раз в месяц.

Для сохранения высокой коллоидной стабильности полученных латексных диагностикумов с разными функциональными группами в систему вводили стабилизаторы, которые адсорбировались на границе раздела фаз и вследствие этого снижали избыточную энергию поверхности частиц. В качестве стабилизаторов использовали катионное поверхностно-активное вещество (ПАВ) (2-оксиэтил)-триметиламмоний хлорид, а также анионное ПАВ лаурилсульфат натрия (SDS). При этом блокирование сайтов неспецифического связывания не проводили. Латексные частицы хранили в буферном растворе с разными концентрациями анионных ПАВ (5, 10, 20, 50, 75, 100 ммоль/л). В течение 10 месяцев с периодичностью раз в месяц проводили оценку коллоидной стабильности и количественной чувствительности латексных препаратов, которые хранили в буферных растворах с использованием ПАВ.

Определение степени адсорбции антител на поверхности латекса.

Степень сенсибилизации латексов определяли спектрофотометрическим методом при длине волны 280 нм и в ТФ непрямом варианте ИФА. Процент адсорбции антител на поверхности латексных частиц рассчитывали по формуле:

1- x 100% (1) Выявление вируса ИНГТ в РАЛ. Для проведения реакции использовали 10%-ную суспензию патологического материала лососевых рыб, которую центрифугировали в течение 20 минут при 1000g для получения супернатанта проб. Положительным и отрицательным контролями при постановке РАЛ служили 10%-ные суспензии клеток RTG-2, инфицированные и неинфицированные вирусом ИНГТ (штамм «Аркус 32/87») с титром инфекционной активности 7,0 lg ТЦД50/мл.

РАЛ проводили на обычных предметных стеклах размером 12х8 см, на которые маркером наносили разметку в виде кругов диаметром 2-3 см по количеству проб и контрольных препаратов (для спонтанной агглютинации – глицин-белковый буферный раствор (ГББР) (ГСБР с добавлением 1% BSA), отрицательный контроль (К-), положительный контроль (К+)). В центр каждого круга вносили по 50 мкл супернатанта проб, затем по 10 мкл латексного диагностикума и перемешивали, распределяя смесь равномерно по всей площади круга.

Реакцию учитывали в течение первых 10 минут (вторично - через 30 минут) от начала её постановки. Результаты оценивали визуально по системе 4 крестов:

«++++» - крупнозернистая агглютинация на фоне прозрачной жидкости; «+++» мелкозернистая агглютинация на полупрозрачном фоне; «++» - мелкозернистая агглютинация на мутном фоне; «+» - слабозаметная агглютинация на мутном фоне; «» - отсутствие агглютинации, фон равномерно мутный.

Положительным результатом считали агглютинацию на 2-4 креста.

Сомнительным считали результат, при котором агглютинация оценивалась на 1 крест. Отрицательным был результат, который характеризовался отсутствием агглютинации. РАЛ учитывали, если с положительным контрольным препаратом наблюдалась агглютинация на 3-4 креста, а с отрицательным контрольным препаратом и с ГСБР отсутствовала (рисунок 7).

Рисунок 7 – Система четырех крестов для оценки результатов РАЛ при выявления вируса ИНГТ Выделение РНК вируса ИНГТ. Экстракцию вирусной РНК из образцов биологического материала и удаление посторонних примесей проводили с помощью набора «Рибо-Сорб» (ЦНИИЭМ, г. Москва) согласно инструкциям производителей. Полученный экстракт РНК вируса ИНГТ хранили при минус 20°С.

ОТ-ПЦР-РВ с применением диагностических ПЦР-чипов для выявления вирусов рыб. Для работы применяли амплификатор «АриаDNA»

(ООО «Люмэкс-Маркетинг»), который осуществлял термоциклирование и детектирование продуктов ПЦР в режиме «реального времени» в микрореакторах чипа с применением двухканального флуоресцентного детектора. С помощью разработанной тест-системы проводили как качественный, так и количественный анализ содержания РНК вирусов ИНГТ, ВГС и ВВК. Обратную транскрипцию и ПЦР проводили в одном микрореакторе без прерывания процесса, поэтому полученные смеси объединяли и лиофильно высушивали на дне реакторов заранее. На поверхности дна каждого микрореактора в лиофилизированном состоянии находится смесь реагентов для ОТ-ПЦР-РВ (для лиофилизации в каждый микрореактор внесили по 1,2 мкл следующей смеси: 0,150 мкл смеси дезоксирибонуклеотидтрифосфатов (10 ммоль каждого), 0,144 мкл Random Hexamers (5 пмоль), 0,144 мкл RNase Inhibitor (20 U/мкл), 0,144 мкл обратной транскриптазы (50 U/мкл), 0,144 мкл хлористого магния (25 ммоль), по 0,047 мкл праймеров и зондов, меченых FAM и ROX (5 пмоль), 0,012 мкл Taq-ДНК-полимеразы (5 ед/мкл), 0,20 мкл трегалозы, которая используется в качестве криопротектора). В лунки с положительными контролями также вносили плазмидные векторы pGEM-3Zf (с сайтами рестрикции HindIII/EcoRI), в которые встроены участки гена N вирусов ИНГТ штамм «Аркус 32/87», ВГС штамм «Аланд» и ВВК штамм «Яяла» с размерами 66, 67 и 103 н.п., соответственно. В лунки с отрицательными контролями вносили ДНК генома радужной форели и зеркального карпа. Данные чипы были разработаны совместно с ООО «Люмэкс-Маркетинг» (г. С.Петербург). Буферный раствор для Tag-полимеразы (х10) в объеме 0,12 мкл вносится в микроректор вместе 1,08 мкл с РНК пробы. В качестве внутреннего контрольного образца (ВКО) служила плазмида со встроенной последовательностью размером 100 н.п., состоящая из нескольких участков гена цитохрома b (cyt b) ягуара (Panthera onca) и не вызывающая перекрестной реакции ни с одной из имеющихся тест-систем. Перед проведением анализа реакционную зону ПЦР-чипа покрывали герметизирующей жидкостью (полиметилсалаксан (ПСМ)) в объеме 620 мкл.

В полипропиленовых пробирках на 0,5 мл смешивали 9 мкл раствора РНК и 1 мкл 10-кратного буферного раствора для ОТ-ПЦР-РВ. Для проверки положительных и отрицательных контролей вместо РНК использовали деионизированную воду. В соответствии с топологией чипа (рис. 8) вносили смесь с пробами в микрореакторы в объеме 1,2 мкл под слой герметизирующей жидкости, следя за тем, чтобы не допускать образования пузырьков воздуха в смеси. Аналогично в микрореакторы с контролями вносим смесь для контрольных образцов. Картридж с ПЦР-чипом помещали в термоблок амплификатора «АриаDNA».

ВВК ВКО ВВК ВКО ВВК ВКО ВГС ВГС ВГС ВГС ВГС ВГС

ВВК ВКО ВВК ВКО ВВК ВКО

ИНГТ ИНГТ ИНГТ ИНГТ ИНГТ ИНГТ

ВВК ВКО ВВК ВКО ВВК ВКО

ВКО ВКО ВКО ВКО ВКО ВКО

ВВК ВКО ВВК ВКО ВВК ВКО

К- К- К- К+ К+ К+ ВВК ВКО ВВК ВКО К-ВВК/ К+ВВК/

К-ВКО К+ВКО ВГС ИНГТ ВКО ВГС ИНГТ ВКО

Примечания: Тест-системы: ВГС — вирусная геморрагическая септицемия;

ИНГТ — инфекционный некроз гемопоэтической ткани; ВВК — весенняя виремия карпа; K+ — положительный контрольный образец; K — отрицательный контрольный образец; ВКО — внутренний контрольный образец Рисунок 8 – Схема внесения образцов в микрореакторы чипа Для проведения ОТ реакционную смесь инкубировали в микрочиповом амплификаторе при 37°С в течение 20 мин для наработки первой цепи кДНК.

Затем реакционную смесь прогревали при 94°С в течение 2 мин для разрушения ревертазы. Далее проводили сорок пять циклов ПЦР при следующем температурном режиме: денатурация при 94°С в течение 3 с, отжиг праймеров и элонгация при 60°С в течение 20 с. С целью детектирования использовали зонды, меченые красителями FAM и ROX. Флуоресцентный сигнал, соответствующий наличию фрагментам РНК вирусов ИНГТ, ИНПЖ, ВГС, ВВК детектировался по каналу 1 (FAM), фрагменты ДНК ВКО — по каналу 2 (ROX).

Результат анализа считали достоверным, если были выполнены следующие условия:

1) для положительных контролей ПЦР флуоресцентный сигнал превышал пороговое значение (кривые на графике пересекают пороговую линию);

2) для отрицательных контролей ПЦР флуоресцентный сигнал не превышал пороговое значение (кривые на графике не пересекают пороговую линию).

В противном случае результаты анализа считали недействительными, и рекомендовали повторную постановку реакции.

РНК возбудителей выявлена, если в соответствующем микрореакторе чипа флуоресцентный сигнал по каналу 1 (флуорофор FAM) превышал пороговое значение. РНК возбудителей не обнаружена, если в соответствующем микрореакторе чипа по каналу 1 (FAM) регистрировался флуоресцентный сигнал ниже порового значения, и при этом для внутреннего контроля ПЦР по каналу 2 (ROX) флуоресцентный сигнал регистрировался выше порового значения.

Оценка эффективности амплификации. Для оценки эффективности амплификации тестировали десятикратные разведения РНК вирусов ИНГТ, ВГС и ВВК в трех повторах, получали средние значения порогового цикла амплификации (Ct) и определяли значения коэффициентов b и k в соответствии с уравнением функции Ct = k·lgСДНК+b. Эффективность реакции рассчитывали по формуле:

E = (10-1/k-1)·100% (2) Электрофорез ДНК в агарозном геле и очистка ПЦР-продуктов.

Электрофорез проводили согласно методу, описанному J. Sambrook с соавторами (1989 г.) [144]. Очистку ПЦР-продуктов от агарозного геля проводили с помощью набора GeneJET Gel Extraction Kit (Thermo Scientific), согласно инструкции производителя.

Работу по Определение нуклеотидных последовательностей.

определению и выравниванию нуклеотидных последовательностей для теоретического анализа праймеров проводили с использованием программы MEGA 5.05 по алгоритму Clustal W на базе ООО «Люмэкс-Маркетинг» [116, 145].

Статистическая обработка результатов. Статистическая обработка включала расчеты средних арифметических значений, коэффициентов вариации, достоверности статистической разницы между средними величинами, определенными по разностному методу Стьюдента-Фишера, расчет стандартных отклонений результатов определения титров вируса, выраженных в lg ТЦД50/см3, обработку результатов, построение графиков и диаграмм с использованием пакета прикладных программ StatSoft (версия 6.0) и Microsoft Excel 2010, а также методов, приведенных в руководствах Ашмарина И.П., Гланца, Джупины С.И., Лакина Г.Ф. и др. [2, 10, 13, 26, 35, 45].

3.2 Результаты собственных исследований 3.2.1 Поиск оптимальных условий для получения культурального антигена вируса ИНГТ Проводили поиск клеточной линии рыб, наиболее чувствительной к вирусу ИНГТ. При этом также оценивали стабильность его культуральных свойств. Для этого осуществляли культивирование штамма «Аркус 32/87» и изолята «Воронин 14/08» вируса ИНГТ в перевиваемых культурах клеток гонад радужной форели (RTG-2), папулезной эпителиомы карпа (EPC), хвостового стебля черного толстоголова (FHM), чувствительность которых к вирусу проверяли в течение 15 последовательных пассажей. Для определения инфекционной активности вируса в монослоях 1-3-суточных культур клеток RTG-2, EPC, FHM, выращенных в культуральных флаконах, проводили титрование. Учет результатов проводили ежедневно на протяжении 7-10 суток по наличию специфических изменений монослоя клеток в зараженных лунках микропланшета и по их отсутствию в контрольных лунках. Титр вируса ИНГТ рассчитывали по методу Рида и Менча. Результаты исследования представлены в таблице 4.

Таблица 4 - Исследование стабильности культуральных свойств штамма «Аркус 32/87» и изолята «Воронин 14/08» вируса ИНГТ в перевиваемых клеточных линиях RTG-2, EPC, FHM (n=3) Титр инфекционной активности вируса, lg ТЦД50/см3 Штамм/изолят Культура вируса ИНГТ клеток 1 пассаж 3 пассаж 5 пассаж 8 пассаж 10 пассаж 15 пассаж «Аркус 32/87» RTG-2 5,02±0,15 5,60±0,12 6,01±0,14 6,51±0,16 7,25±0,18 7,35±0,12 EPC 4,85±0,13 5,42±0,15 5,88±0,17 6,34±0,13 7,01±0,16 7,13±0,14 FHM 4,82±0,13 5,36±0,17 5,79±0,14 6,29±0,13 6,93±0,20 7,05±0,14 «Воронин RTG-2 4,87±0,15 5,44±0,12 5,87±0,14 6,36±0,16 7,11±0,18 7,24±0,12 14/08» EPC 4,71±0,13 5,23±0,15 5,70±0,17 6,23±0,13 6,87±0,16 7,01±0,15 FHM 4,62±0,13 5,11±0,17 5,54±0,14 6,12±0,13 6,75±0,20 6,88±0,11

–  –  –

Результаты исследования отражены в таблице 5, из которой следует, что при инфицировании клеточного монослоя вирусом в дозах 0,01 – 1,00 ТЦД50/кл., накопление штамма «Аркус 32/87» обеспечивалось на уровне 6,14 – 7,25 lg ТЦД50/см3 на 4-8 сутки при поражении клеточного монослоя на 90-100%.

–  –  –

Результаты представлены в таблице 6, из которой следует, что при дозе заражения 0,01 – 0,05 ТЦД50/кл. культивирование штамма «Аркус 32/87» и изолята «Воронин 14/08» вируса ИНГТ оптимально при концентрации сыворотки крови КРС 1%. В этих условиях на 7 сутки накопление штамма «Аркус 32/87» обеспечивалось на уровне 7,25±0,18 lg ТЦД50/см3, а изолята «Воронин 14/08» - на уровне 7,11±0,18 lg ТЦД50/см3 при поражении клеточного монослоя на 90-100%. Отсутствие сыворотки или увеличение ее количества до 5 и 10% приводило к снижению титра накопления вируса.

Увеличение дозы заражения до 0,05-0,10 ТЦД50/кл. при тех же концентрациях сыворотки крови КРС вызывало снижение уровня накопления вируса. Следовательно, наиболее высокие значения титра инфекционной активности штамма «Аркус 32/87» и изолята «Воронин 14/08» вируса ИНГТ наблюдались при дозе заражения 0,01 – 0,05 ТЦД50/кл. и содержании сыворотки крови КРС в составе поддерживающей среды 1%.

Таким образом, штамм «Аркус 32/87» и изолят «Воронин 14/08» имели примерно одинаково высокие титры накопления вируса в культуре клеток RTG-2. При этом референтный штамм «Аркус 32/87» в большей степени изучен, депонирован в Коллекцию штаммов микроорганизмов ФГБУ «ВНИИЗЖ», что позволило использовать его в качестве источника для получения культурального антигена с дальнейшей наработкой вирусспецифичных сывороток и моноклональных антител.

Для получения культурального антигена вируса ИНГТ использовали штамм «Аркус 32/87», который культивировали в 1-3-суточном монослое клеточной линии RTG-2, выращенном в среде Игла ДМЕМ с содержанием фетальной сыворотки крови КРС 1%. Инфицированную культуру клеток инкубировали при 15°С до появления ЦПД вируса, которое характеризовалось округлением клеток, скоплением их в группы по 20-30 и в дальнейшем с тотальной деструкцией клеточного монослоя. Характер наблюдавшегося проявления ЦПД вируса ИНГТ в монослое культуры клеток RTG-2 представлен на рисунке 9.

–  –  –

По результатам электрофореза, образец антигена вируса ИНГТ не содержал посторонних белков (рис. 10).

Таким образом, полученный очищенный вирус ИНГТ был пригоден для разработки диагностических тест-систем на основе ОТ-ПЦР-РВ, а также для иммунизации животных с целью получения вирусспецифичных сывороток и моноклональных антител.

3.2.2 Получение и характеристика моноклональных антител к антигенам вируса ИНГТ Гибридомы, продуцирующие моноклональные антитела (МА) к вирусу ИНГТ, получали по стандартной схеме, представленной в главе «Материалы и методы», совместно с ФГБУН ИБХ им. М.М. Шемякина и Ю.А. Овчинникова РАН (г. Москва). По данным ТФ непрямого варианта ИФА, титр специфичных антител в сыворотке крови мышей, иммунизированных вирусом ИНГТ, составил 1:48000. За счет гибридизации лимфоцитов селезенки иммунных мышей линии BALB/с с клетками миеломы SP 2/0 было отобрано 18 стабильных клонов. Все клоны-продуценты трехкратно подвергались клонированию методом

–  –  –

моноклональных антител характеризовались высокой степень чистоты, о чем свидетельствовали результаты электрофореза.

Рисунок 11 – Электрофореграмма препаратов МА против вируса ИНГТ, выделенных из асцитов № 1-18 (по результатам электрофореза в 12,5% SDS-ПААГ в восстанавливающих условиях) Для оценки специфичности связывания полученных МА с белками вируса ИНГТ проводили вестерн-блот-анализ. Иммунодетекцию блотов осуществляли в одинаковых условиях. Констатация наличия и интенсивности полос свидетельствовала о специфичности МА к антигенам вируса ИНГТ. Результаты представлены на рисунке 12 и в таблице 9.

Рисунок 12 – Вестерн-блот-анализ связывания МА (№ 1-18) с белкамивируса ИНГТ

Согласно этим данным, МА №4 и 17 взаимодействовали исключительно с нуклеопротеином, высококонсервативным белком вируса ИНГТ. Антитела №6 и 15 были активными к G-белку, №2, 5, 10, 12, 13, 14 – к P-белку. Антитела №16 проявляли специфичность по отношению к L-белку вируса ИНГТ.

Специфичность к матриксному белку была выявлена у антител № 1, 3, 11, которые при этом проявляли активность и к фосфопротеину вируса ИНГТ.

Также были выделены антитела №7, 8, 9, которые одновременно проявляли свою активность по отношению к L-, G- и P-белкам, №5 и 18 - к G- и P-белкам.



Pages:     | 1 || 3 | 4 |   ...   | 5 |

Похожие работы:

«АСБАГАНОВ Сергей Валентинович БИОЛОГИЧЕСКИЕ ОСНОВЫ ИНТРОДУКЦИИ РЯБИНЫ (SORBUS L.) В ЗАПАДНОЙ СИБИРИ 03.02.01 – «Ботаника» ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный руководитель: к.б.н., с.н.с. А.Б. Горбунов Новосибирск 2014 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ.. 4 Глава 1. ОБЗОР ЛИТЕРАТУРЫ.. 8 Ботаническая...»

«Цвиркун Ольга Валентиновна ЭПИДЕМИЧЕСКИЙ ПРОЦЕСС КОРИ В РАЗЛИЧНЫЕ ПЕРИОДЫ ВАКЦИНОПРОФИЛАКТИКИ. 14.02.02 – эпидемиология ДИССЕРТАЦИЯ на соискание ученой степени доктора медицинских наук Научный консультант: заслуженный деятель науки РФ, лауреат Государственной премии СССР профессор, доктор медицинских наук Ющенко Галина Васильевна Москва – 20 Содержание...»

«АБДУЛЛАЕВ Ренат Абдуллаевич ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ МЕСТНЫХ ФОРМ ЯЧМЕНЯ ИЗ ДАГЕСТАНА ПО АДАПТИВНО ВАЖНЫМ ПРИЗНАКАМ Шифр и наименование специальности 03.02.07 – генетика 06.01.05 – селекция и семеноводство сельскохозяйственных растений ДИССЕРТАЦИЯ на соискание учёной степени кандидата...»

«Петухов Илья Николаевич РОЛЬ МАССОВЫХ ВЕТРОВАЛОВ В ФОРМИРОВАНИИ ЛЕСНОГО ПОКРОВА В ПОДЗОНЕ ЮЖНОЙ ТАЙГИ (КОСТРОМСКАЯ ОБЛАСТЬ) Специальность: 03.02.08 экология (биологические науки) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, профессор В.В. Шутов...»

«Палаткин Илья Владимирович Подготовка студентов вуза к здоровьесберегающей деятельности 13.00.01 общая педагогика, история педагогики и образования Диссертация на соискание ученой степени кандидата педагогических наук Научные руководители: доктор биологических наук, профессор,...»

«Брит Владислав Иванович «Эффективность методов вакцинации против ньюкаслской болезни в промышленном птицеводстве» Специальность: 06.02.02 ветеринарная микробиология, вирусология, эпизоотология, микология с микотоксикологией и иммунология ДИССЕРТАЦИЯ на соискание ученой степени кандидат ветеринарных наук Научный руководитель:...»

«ХАПУГИН Анатолий Александрович РОД ROSA L. В БАССЕЙНЕ РЕКИ МОКША 03.02.01 – ботаника Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель Силаева Татьяна Борисовна д.б.н., профессор САРАНСК ОГЛАВЛЕНИЕ ВВЕДЕНИЕ Глава 1. ИСТОРИЯ ИЗУЧЕНИЯ РОДА ROSA L. В БАССЕЙНЕ МОКШИ. Глава 2. КРАТКАЯ ХАРАКТЕРИСТИКА РОДА ROSA L. 2.1. Характеристика рода Rosa L. 2.2. Систематика рода Rosa L. Глава 3....»

«ПИМЕНОВА ЕКАТЕРИНА ВЛАДИМИРОВНА РАЗРАБОТКА МЕТОДА ОЦЕНКИ ЦИТОТОКСИЧНОСТИ АНТИГЕНОВ ВОЗБУДИТЕЛЯ МЕЛИОИДОЗА IN VITRO НА МОДЕЛИ ПЕРЕВИВАЕМЫХ КЛЕТОЧНЫХ КУЛЬТУР 03.02.03 – микробиология Диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор...»

«АБДУЛЛАЕВ Ренат Абдуллаевич ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ МЕСТНЫХ ФОРМ ЯЧМЕНЯ ИЗ ДАГЕСТАНА ПО АДАПТИВНО ВАЖНЫМ ПРИЗНАКАМ Шифр и наименование специальности 03.02.07 – генетика 06.01.05 – селекция и семеноводство сельскохозяйственных растений ДИССЕРТАЦИЯ на соискание учёной степени кандидата...»

«Храмцов Павел Викторович ИММУНОДИАГНОСТИЧЕСКАЯ СИСТЕМА ДЛЯ ОЦЕНКИ НАПРЯЖЕННОСТИ ПОСТВАКЦИНАЛЬНОГО ИММУНИТЕТА К КОКЛЮШУ, ДИФТЕРИИ И СТОЛБНЯКУ 14.03.09 – Клиническая иммунология, аллергология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, Раев Михаил Борисович...»

«Ульянова Онега Владимировна МЕТОДОЛОГИЯ ПОВЫШЕНИЯ БЕЗОПАСНОСТИ БАКТЕРИАЛЬНЫХ ВАКЦИН НА МОДЕЛИ ВАКЦИННЫХ ШТАММОВ BRUCELLA ABORTUS 19 BA, FRANCISELLA TULARENSIS 15 НИИЭГ, YERSINIA PESTIS EV НИИЭГ 03.02.03 – микробиология Диссертация на соискание ученой степени доктора биологических наук Научный консультант:...»

«Якимова Татьяна Николаевна Эпидемиологический надзор за дифтерией в России в период регистрации единичных случаев заболевания 14.02.02 эпидемиология диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор...»

«Кириллин Егор Владимирович ЭКОЛОГИЯ ОВЦЕБЫКА (OVIBOS MOSCHATUS ZIMMERMANN, 1780) В ТУНДРОВОЙ ЗОНЕ ЯКУТИИ 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: д. б. н., профессор Мордосов И. И. Якутск – 2015 Содержание Введение.. Глава 1. Краткая физико-географическая...»

«Ядрихинская Варвара Константиновна ЭКОЛОГИЧЕСКИЕ ОСОБЕННОСТИ РАСПРОСТРАНЕНИЯ ОСТРЫХ КИШЕЧНЫХ ИНФЕКЦИЙ В Г. ЯКУТСКЕ И РЕСПУБЛИКЕ САХА (ЯКУТИЯ) 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель кандидат биологических наук, доцент М.В. Щелчкова Якутск 2015...»

«БРИТАНОВ Николай Григорьевич ГИГИЕНИЧЕСКИЕ АСПЕКТЫ ПЕРЕПРОФИЛИРОВАНИЯ ИЛИ ЛИКВИДАЦИИ ОБЪЕКТОВ ПО ХРАНЕНИЮ И УНИЧТОЖЕНИЮ ХИМИЧЕСКОГО ОРУЖИЯ 14.02.01 Гигиена Диссертация на соискание ученой степени доктора медицинских наук Научный консультант: доктор медицинских наук, профессор...»

«Сухарьков Андрей Юрьевич РАЗРАБОТКА МЕТОДОВ ОЦЕНКИ ОРАЛЬНОЙ АНТИРАБИЧЕСКОЙ ВАКЦИНАЦИИ ЖИВОТНЫХ 03.02.02 «Вирусология» Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: кандидат ветеринарных наук, Метлин Артем Евгеньевич Владимир 2014 ОГЛАВЛЕНИЕ 1 ВВЕДЕНИЕ 2 ОБЗОР ЛИТЕРАТУРЫ 2.1 Характеристика возбудителя бешенства 2.2 Эпизоотологические...»

«БРИТАНОВ Николай Григорьевич ГИГИЕНИЧЕСКИЕ АСПЕКТЫ ПЕРЕПРОФИЛИРОВАНИЯ ИЛИ ЛИКВИДАЦИИ ОБЪЕКТОВ ПО ХРАНЕНИЮ И УНИЧТОЖЕНИЮ ХИМИЧЕСКОГО ОРУЖИЯ 14.02.01 Гигиена Диссертация на соискание ученой степени доктора медицинских наук Научный консультант: доктор медицинских наук, профессор...»

«СЕРГЕЕВА ЛЮДМИЛА ВАСИЛЬЕВНА ПРИМЕНЕНИЕ БАКТЕРИАЛЬНЫХ ЗАКВАСОК ДЛЯ ОПТИМИЗАЦИИ ФУНКЦИОНАЛЬНО-ТЕХНОЛОГИЧЕСКИХ СВОЙСТВ МЯСНОГО СЫРЬЯ И УЛУЧШЕНИЯ КАЧЕСТВА ПОЛУЧАЕМОЙ ПРОДУКЦИИ Специальность 03.01.06 – биотехнология ( в том числе бионанотехнологии) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель Доктор биологических наук, профессор Кадималиев Д.А. САРАНСК 2014 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ.....»

«Шапурко Валентина Николаевна РЕСУРСЫ И ЭКОЛОГИЧЕСКОЕ КАЧЕСТВО ЛЕКАРСТВЕННЫХ РАСТЕНИЙ (НА ПРИМЕРЕ БРЯНСКОЙ ОБЛАСТИ) Специальность 03.02.08 – экология (биологические науки) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор...»

«МИГИНА ЕЛЕНА ИВАНОВНА ФАРМАКОТОКСИКОЛОГИЯ И ЭФФЕКТИВНОСТЬ ИСПОЛЬЗОВАНИЯ КОРМОВОЙ ДОБАВКИ ТРИЛАКТОСОРБ В МЯСНОМ ПЕРЕПЕЛОВОДСТВЕ 06.02.03 – ветеринарная фармакология с токсикологией Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, профессор Кощаев Андрей...»







 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.