WWW.KONF.X-PDF.RU
БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Авторефераты, диссертации, конференции
 


Pages:     | 1 || 3 | 4 |

«ИСПОЛЬЗОВАНИЕ ТЕХНОЛОГИЙ ДНК-МАРКИРОВАНИЯ В СЕЛЕКЦИОННО-ГЕНЕТИЧЕСКИХ ИССЛЕДОВАНИЯХ ЯБЛОНИ ...»

-- [ Страница 2 ] --

Помимо перечисленных выше «главных» генов устойчивости известны различные полигенные источники, обеспечивающие устойчивость яблони к парше. Это так называемые количественные локусы (quantitative trait loci – QTLs), которые несут горизонтальную (полевую) устойчивость к парше с незначительным фенотипическим проявлением и представляют собой аналоги резистентных генов (resistance gene analogs – RGA) [Soufflet-Freslon V. et al., 2008].

С тех пор как патоген стал преодолевать устойчивость основных генов резистентности, возникла необходимость пирамидирования главных генов или их сочетание с другими источниками устойчивости в одном генотипе для длительной устойчивости яблони к парше. Развитие селекционных технологий и методов молекулярного ДНК-маркирования, и появления технологии маркерной селекции (marker assisted selection – MAS) дает возможность значительного повышения эффективности при решении данной задачи [Супрун И.И. и др., 2010; Ульяновская Е.В., 2007].

–  –  –

Важнейшей характеристикой любой селекционной коллекции является генетическая изменчивость или полиморфизм, обусловленный несколькими наследственными факторами с дискретным фенотипическим эффектом. Для изучения уровня генетического полиморфизма генофонда яблони необходимо использовать наиболее эффективные типы маркерных систем. Оценка уровня полиморфизма необходима для выбора селекционной стратегии по комбинированию хозяйственно-ценных признаков в программах по выведению новых сортов яблони [Oraguzie N.C. et al., 2001].

Первая генетическая карта яблони, построенная с применением изоэнзима, RFLP- и RAPD-маркеров, была опубликована Hemmat M. с соавторами (1994 г.) для гибрида Rome Beauty White Angel. P. Conner (1997 г.) с соавторами предложил более подробную карту, что способствовало развитию селекции устойчивых к парше сортов яблони на молекулярном уровне [Sladana M. et al., 2010].

С использованием изоэнзимов, RFLPs, RAPDs, AFLPs, SCARs и SSRмаркеров при исследовании популяции 152 сеянцев была создана генетическая карта с 17 группами сцепления (как и гаплоидный набор хромосом яблони, n=17) для сортов Прима и Фиеста [Maliepaard C. et al., 1998].

В исследованиях по изучению генетики различных хозяйственно-ценных признаков яблони часто используют подробную генетическую карту яблони, созданную R. Liebhard с соавторами (2003 г.) [Liebhard R. et al., 2003].

F. Fernandez-Fernandez с соавторами (2008 г.) описал разработки генетической карты с использованием 247 микросателлитных маркеров, 4 SCAR-маркеров и 8 хорошо изученных генов, 5 из которых контролируют ценные сельскохозяйственные признаки, такие как устойчивость к парше, мучнистой росе, гены колоноводности кроны и окраски плодов [FernandezFernandez F. et al., 2008].

Для оценки достоверности результатов картирования, полученных независимыми исследованиями, необходимы эффективные типы маркерных систем [Gardiner S.E. et al., 2007]. В этом отношении незаменимы микросателлитные маркеры, т.к. они кодоминантны, высоко полиморфны, широко распространены и их результаты легко воспроизвести.

Микросателлиты идеально подходят для картирования локусов количественных признаков и универсальны между культурами [Kenis K. et al., 2005; Liebhard R.

et al., 2002, 2003].

R. Liebhard c соавторами впервые идентифицировал 140 микросателлитных локусов и праймерные пары, их фланкирующие, со средним уровнем полиморфизма 6,1 аллеля на локус. Для всех маркеров была определена позиция на генетической карте потомства, полученного от скрещивания сортов яблони Fiesta Discovery и идентифицировано 17 групп сцепления, соответствующих хромосомам яблони [Liebhard R. et al., 2002].

Рассмотрена возможность применения микросателлитных маркеров для других видов семейства Розоцветных. В дальнейшем идентифицированные микросателлитные локусы были использованы для создания генетической карты яблони [Alston F.H. et al., 2000; Liebhard R. et al., 2003].

В ходе исследований с соавторами E. Silfverberg-Dilworth идентифицировал 148 новых SSR-локусов в геноме яблони и провел их картирование на генетической карте Fiesta Discovery [Silfverberg-Dilworth E.

et al., 2006].

Микросателлитные маркеры идеально подходят для анализа филогенетических взаимоотношений на внутри- и межвидовом уровне. Так, M.

Muzher Bayan с соавторами использовал SSR-маркеры в сочетании с AFLP- и RAPD-маркерными системами для изучения генетического родства шести сирийских сортов яблони. Уровень полиморфизма исследуемых образцов составил 82,7%, 100% и 91,7%, выявленный соответственно RAPD-, SSR- и AFLP-маркерами [Bayan M.M. et al., 2007].

Микросателлитные маркеры успешно применялись в работе Christopher M. Richards с соавторами для оценки генетического полиморфизма 949 образцов сеянцев, полученных от 8 популяций Malus sieversii (Lebed.) M. Roem.

из Казахстана [Christopher M.R. et al., 2009].

Главный недостаток микросателлитных маркеров – это необходимость их предварительного создания, картирования и апробации. Несмотря на то, что для яблони было создано около 160 SSR-маркеров, распределение их по всему геному не является гомогенным [Gianfranceschi L. et al., 1998; Hemmat M. et al., 2003; Hokanson S.C. et al., 1998; Liebhard R. et al., 2002; Vinatzer B.A. et al., 2004]. Почти все группы сцепления содержат области со значительными пробелами между двумя последовательными микросателлитами [Liebhard R. et al., 2003]. Создание новых микросателлитных маркеров может решить данную проблему.

В настоящее время именно микросателлитные маркеры нашли широкое применение в популяционно-генетических исследованиях, направленные на изучение степени генетического полиморфизма яблони. A. Patocchi с соавторами оценил полиморфизм порядка двух тысяч образцов (359 сортов и 27 гибридных популяций объемом от 26 до 98 гибридных растений) из коллекции генетических ресурсов европейского консорциума по устойчивому возделыванию яблони (European High-quality Disease-Resistant Apples for a Sustainable agriculture project) с использованием 88 микросателлитных ДНКмаркеров. A. Patocchi показал, что SSR-маркеры могут использоваться для мультиплексной ПЦР [Patocchi A. et al., 2005].

Микросателлитные маркеры успешно применяются для оценки степени генетического полиморфизма на молекулярном уровне для идентификации клонов. Так, N.C. Oraguzie с соавторами в 2005 г. провел скрининг с помощью семи SSR-маркеров 66 клонов яблони для того, чтобы установить их генетическую идентичность [Oraguzie N.C. et al., 2005].

Для генотипирования яблони SSR-маркеры широко применяются в различных странах. Так, в Испании, в Боснии и Герцеговине независимо проводились работы по выяснению генеалогии некоторых местных сортов, позволившие внести ясность в вопросы, касающиеся происхождения образцов [Bayan M.M. et al., 2007; Pereira-Lorenzo S. et al., 2007].

В 2010 г. F. Gasia с соавторами с применением десяти SSR-маркеров сравнили местные сорта яблони в Боснии и Герцеговины с международными сортами яблони, получив значительные статистически достоверными различия [Gasia F. et al., 2010].

S. Pereira-Lorenzo с соавторами (2008 г.) с применением десяти микросателлитных маркеров рассматривают местные сорта яблони с Канарских островов как ценный генетический ресурс для субтропических областей ввиду обнаружения пяти уникальных аллелей. Уровень полиморфизма используемых маркеров позволил среди образцов с Канарских островов распознать один образец, являющийся гибридом, полученным от сорта Голден Делишес, остальные 30 образцов были разделены на 14 генотипов [Mohan M. et al., 1997;

Pereira-Lorenzo S. et al., 2008].

В Иране A. Gharghani с соавторами (2009 г.) исследовали полиморфизм 159 образцов дикой и домашней яблони, включая M. sieversii и M. orientalis, а также иранские и мировые сорта яблони. Согласно полученным результатам, иранские сорта яблони являются близкородственными с M. sieversii из центральной Азии и занимают промежуточное положение между дикими и одомашненными видами яблони, а M. orientalis ближе всего к русским и турецким видам яблони, следовательно, Иран является одним из мест, где происходило одомашнивание яблони [Gharghani A. et el., 2009].

Сорта яблони из коллекции ВНИИГиСПР проанализированы И.Н.

Шамшиным с соавторами (2013 г.) с применением 15 микросателлитных маркеров, показавших высокое значение коэффициента полиморфизма [Шамшин И.Н. и др., 2013].

Супруном И.И. с соавторами выполнены исследования по оценки уровня информативности и получены ряда SSR-локусов SSR-фингерпринты отечественных сортов яблони из коллекции генетических ресурсов СКЗНИИСиВ и ВНИИСПК наряду с сортами плодовых родов Prunus и Pyrus с использованием мультиплексного фрагментного анализа на автоматическом генетическом анализаторе ABI-Prism 3130 [Супрун И.И. и др., 2013].

В последнее время большой интерес вызывают биохимические и физиологические процессы у яблони, которые обеспечивают различные экономически важные признаки, например, созревание и лежкость плодов [Sladana M. et al., 2010]. Многие сельскохозяйственно-ценные признаки яблони являются полигенными. К таким признакам относятся: продолжительность ювенильного периода, морозостойкость, продолжительность цветения, время созревания, размер, форма, цвет, вкус и аромат плодов и продуктивность Генетическое картирование локусов генов [Janick J. et al., 1996].

количественных признаков (QTLs) заключает в себе идентификацию и определение степени взаимосвязи между этими признаками и используемыми молекулярными маркерами [Gao Z.S. et al., 2005; Gardiner S.E. et al., 2007].

Подробная генетическая карта, покрывающая весь геном необходима для точной идентификации локусов количественных признаков. Если определенные области генома не достаточно покрыты молекулярными маркерами, позиции локусов количественных признаков на генетической карте нельзя считать достоверными [Kenis K. et al., 2007; King G.J. et al., 2000].

Применение маркерных технологий для выявления генетического полиморфизма на уровне ДНК, идентификации и картирования генов, установления филогенетических связей и QTL-анализе уже сейчас представляет собой мощный инструмент, как в теоретических генетических исследованиях, так и в прикладных работах, без которого невозможно повышение эффективности селекционного процесса [Седов Е.Н. и др., 2006; Супрун И.И. и др., 2012].

1.6 Молекулярно-генетический полиморфизм гена самонесовместимости в пределах вида Malus domestica Самонесовместимость – характерная черта многих цветковых растений, препятствующая инбридингу и способствующая ауткроссингу, который приводит к свободному перекомбинированию наследственного материала популяции, реализуя гибридную мощность организмов [Суриков И.М., 1991].

Системы самонесовместимости делят на спорофитные (фенотип пыльцевого зерна определяется диплоидным геномом материнского растения) и гаметофитные (фенотип определяется только генами, которые несёт данное пыльцевое зерно). Яблоня, как и другие представители семейства Rosaceae, принадлежит к растениям с моногенным гаметофитным контролем реакции самонесовместимости [Ефимова И.Л., 2005]. Явление самонесовместимости представляет собой один из наиболее ярких примеров межклеточного взаимодействия и может служить удобной моделью для анализа экспрессии генов [Broothaerts W. et al., 1995].

В системе самонесовместимости гаметофита яблони хорошо известен ген самонесовместимости – это мультигенный комплекс, (S-ген). S-локус включающий S-РНКазный ген, экспрессирущийся в пестике, и специфический F-box ген пыльцы. Продукты S-гена в пестике – цитотоксические протеины с рибонуклеазной активностью (S-РНКазы) [McClure B.A. et al., 1989]. В процессе самонесовместимого взаимодействия контролирует S-РНКазы прорастание пыльцевой трубки, проникая в цитоплазму и деградируя пыльцевую РНК [Broothaerts W. et al., 1995]. Пыльцевые трубки, прорастающие из пыльцы с определенным аллелем S-гена ингибируются в пестиках растений, несущих тот же аллель [Janssens G. A. et al., 1995]. Следовательно, оплодотворение блокируется, когда S-аллель пыльцы совпадает с одним или несколькими пестика [Gao S-аллелями Z.S. et al., 2005]. Sаллелеассоциированные протеины – высокоосновные гликопротеины с приблизительной молекулярной массой около 30 кДа, которые широко представлены в пестике. В основном S-РНКазный протеин состоит из пяти консервативных областей (C1–C5) и одного гипервариабельного участка (RHV), расположенного между С2 и С3.

Данные участки играют главную роль в распознавании собственной и чужой пыльцы, т.к. все эти четыре участка расположены в области активной рестрикции, что дает возможность взаимодействовать с субстратами [Matsuura T. et al., 2001]. S-РНКазы есть как в самонесовместимых, так и в совместимых пыльцевых трубках, но их цитотоксическая роль в задержке прорастания пыльцы проявляется только в случае самонесовместимости [Luu D.T. et al., 2002].

Одна из первых работ, связанных с фертильностью некоторых сортов яблони, относится к 1939 г. В данной работе F. Kobel с соавторами изучал прорастанание пыльцевой трубки и различия между совместимыми, полусовместимыми и несовместимыми гибридами, определил 11 различных Sаллелей яблони (S1 - S11) для 20 местных сртов. Были описаны S-генотипы 14 диплоидных и 12 триплоидных видов [Kobel F. et al., 1939]. Однако S-генотип 5 дополнительно изученных триплоидов был частично установлен и оставшиеся аллели обозначили как Sx или Sy. Позднее в молекулярный анализ включили электрофорез S-РНКаз в гелях, а также изоэлектрическую фокусировку или неравновесный рН-градиент электорофокусирования и детекцию при помощи антител и рубонуклеазной активности, наряду с клонированием и секвенированием ДНК S-аллелей, начавшимися в последней декаде 20 века [Супрун И.И. и др., 2012].

В ранних исследованиях японских сортов яблони S. Komori с соавторами определяет буквенные символы для 10 S-аллелей (Sa-Si и Sz) и сообщает об их соответствии с 4 S-аллелями F. Kobel (2000 г.) [Komori S. et al., 1999]. S-РНКазы яблони были выделены и описаны H. Sassa с соавторами (1994) и W. Broothaerts с соавторами (1995) [Broothaerts W. et al., 1995; Sassa H. et al., 1994]. W.

Broothaerts с соавторами в 1995 г. охарактеризовал S2 и S3-аллели гена самонесовместимости яблони. Продукт S2-аллеля был выделен из пестика сорта Голден Делишес и проявлял себя как РНКаза [Broothaerts W. et al., 1995]. Кроме того, стали применятся биохимические и молекулярные методы для идентификации аллелей S-гена и классификации несовместимых групп яблони и других розоцветных [Ishimizu T. et al., 1999]. H. Sassa с соавторами (1994 г.;

1996 г.) описал аллели Sa-Sf по их продуктам, выявив характерную миграцию образцов в щелочных областях при проведении электрофореза [Sassa H. et al., 1994]. В последствии были добавлены 14 S-аллелей (S12-S25), сиквенс которых в последствии сравнивался с уже известными аллелями S-гена [Boskovic R. et al., 1999].

Общепринятые методы определения самонесовместимости культур сложны в оценке в связи с физиологическими факторами и воздействием окружающей среды поэтому для анализа [Kobel F. et al., 1939], самонесовместимых групп стали использовать изоферменты и S-гликопротеины [Sassa H. et al., 1994], результат которых также довольно трудно интерпретировать [Sakurai K. et al., 2000]. Богатое аллельное разнообразие S-гена позволяет применять ПЦР-анализ с аллелеспецифическими праймерами даже в сочетании с эндонуклеазами рестрикции [Broothaerts W. et al., 2003]. Применение таких маркеров позволяет получать точные знания о системе самонесовместимости у яблони и других культур, которые необходимы для оптимального подбора родительских пар в селекционных программах [Sakurai K. et al., 1997].

S. Matsumoto и K. Kitahara (2000 г.) выделили 9 аллелей S-гена у яблони [Matsumoto S. et al., 2000]. В настоящее время аллели S-РНКазы выделены и у других диких азиатских видов яблони: S34 и S35 из Malus sieversii, а также S`g из Malus transitoria [Matsumoto S. et al., 2001]. Предварительный анализ этих генетических последовательностей показал, что SCAR-маркеры могут успешно применяться для определения S-РНКазного генотипа M. sylvestris, что позволяет оценить степень сходства нуклеотидных последовательностей аллелей S-гена, распространенных в генплазме M. sylvestris и M. domestica.

В связи с несовершенством классификации S-аллелей W. Broothaerts (2003 г.) предложил четырем S-аллелям присвоить новые номера, а аллели, имеющие в названии буквы греческого алфавита, соответственно пронумеровать.

Шесть дополнительных аллелей были распознаны по их РНКазам: S8, S13, S14, S15, S17, S18 и S21, не смотря на то, что S14, S17 и S21 можно объединить в одну группу S14/17/21. Аллели, генетический продукт которых ранее не был описан, получили другие номера. Для облечения дальнейшего анализа S-генотипа определены общие сорта, которые могут функционировать как контроль отдельных аллелей S-гена [Broothaerts W., 2003].

Аллельные комбинации S-гена (S-генотипы) определяют разнообразными методами, однако молекулярно-генетический подход с применением мультиплексных смесей для ПЦР считается приоритетным. Кроме того, 10 SРНКаз яблони [(Sc, Sd, Se, St, Sg, Sg, Sh, Si, St, и Sz] клонированы и секвенированы в Японии [Matsumoto S. et al., 2000, 2001] так же как и 11 аллелей (S2, S3, S4, S5, S7, S9, S24, S26, S27a, S27b, S30(=28)) – в Европе [Broothaerts W. et al., 1995].

В настоящее время широко ведутся работы по определению S-генотипов различных сортов яблони, необходимые для мировой селекции данной культуры. Так, Taek Kim Hoy с соавторами изучил S-генотип 14 корейских сортов яблони, обнаружив аллели S1, S2, S3, S5, S7, S9, S19 [Hoy T.K. et al., 2006].

S.G. Dreesen Rozemarijn (2010 г.) с соавторами провели генотипирование более трехсот образцов M. sylvestris, M. domestica и внутривидовых гибридов M. sylvestris – M. domestica с применением молекулярных SCAR-маркеров.

Оказалось, что разнообразие S-РНКаз было выше у M. sylvestris, чем у M.

domestica, что свидетельствует о негативном влиянии одомашнивания на аллельный полиморфизм S-гена. Тем не менее, большинство S-аллелей M. domestica обнаружены и у M. sylvestris, что говорит об устойчивой структуре S-гена [Rozemarijn S.G.D. et al., 2010].

В 2010 г. описаны три новых аллеля S-гена: S44, S45 и S46 с соответствующими аллелеспецифическими праймерами. Основываясь на данных о нуклеотидной последовательности S-гена, большую популярность получили методы, основанные на ПЦР с применением специфических RFLP-маркеров [Shenshan L. et al., 2010].

A. Hegeds, проанализировав многолетние данные мировой литературы, обозначил наиболее распространенные в мировой генетической плазме яблони аллели S-гена: S2, S3, S7, S10 [Hegeds A., 2006]. Необходимо отметить, что сорта Прима, Голден Делишес, Айдаред, Джонатан, Джонаголд, которые наиболее часто применяются как родительские формы у современных сортов и селекционных форм яблони в России, послужили наиболее широкому распространению в современной отечественной генплазме яблони таких аллелей как S2, S3 и S10 [Супрун И.И. и др., 2013].

Наличие у двух разных сортов общих S-генотипов является причиной их несовместимости при опылении, в этом случае скрещивание не дает потомства, следовательно, знание S-генотипов необходимо для улучшения эффективности перекрестного опыления. Полусовместимые сорта, которые несут по какомунибудь одному S-аллелю, зачастую произрастают совместно в одном саду, что не является оптимальным [Суриков И.М., 1991]. Для окультуренной яблони механизм самонесовместимости зачастую мешает регуляции сельскохозяйственного процесса выращивания, например, при интрогрессиии нужных генов, следовательно, знание S-генотипа необходимо для разработки оптимальных программ гибридизации [Супрун И.И. и др., 2012].

Данные об аллельном составе гена самонесовместимости являются неотъемлемой частью ДНК-паспортов сортов яблони. Причем получить такой паспорт представляется затруднительным без применения ДНК-маркерных технологий, для которых не требуются полевые испытания и специфические лабораторные анализы, необходимые для скрининга фенотипических проявлений данного признака. Тем более идентифицировать аллельный набор гена самонесовместимости у селекционных форм яблони с применением ДНКмаркерного анализа возможно еще до вступления их в фазу цветения – немаловажное преимущество анализа данного типа [Гостимский С.А. и др., 1999].

Таким образом, анализ литературных данных показал, что применение в генетических исследованиях методов, основанных на ДНК-маркировании, значительно повышает эффективность оценки растительного материала по многим интересующим хозяйственно-ценным признакам. Яблоня как ведущая мировая плодовая культура всегда будет актуальным объектом селекционных исследований.

Изучение отечественной генплазмы яблони с целью создания сортов, отвечающих требованиям современных технологий, диктует необходимость развития новых направлений исследований, в частности:

– изучение генетического полиморфизма яблони в сравнении с другими плодовыми культурами на внутри- и межвидовом уровне;

– выявление доноров хозяйственно-ценных признаков при массовом скрининге селекционного материала яблони с возможностью одновременной идентификации нескольких генов в одном образце;

– паспортизация генофонда яблони с применением оптимальной выборки микросателлитных маркеров с высоким уровнем аллельного полиморфизма;

– создание базы данных ДНК-паспортов сортов яблони, в которых отражены результаты микросателлитного генотипирования; информация о генах, представляющих интерес для селекции, а также данные о гомо- или гетерозиготном состоянии локуса целевого гена; аллельный состав гена самонесовместимости.

2 УСЛОВИЯ, МАТЕРИАЛ И МЕТОДИКА ПРОВЕДЕНИЯ

ИССЛЕДОВАНИЙ

–  –  –

Исследования проводились с 2008 г. по 2011 г. в секторе генетических и статистических исследований Северокавказского зонального научноисследовательского института садоводства и виноградарства

Россельхозакадемии с использованием следующего оборудования:

ДНК-амплификатор Терцик, Eppendorf Mastercycler gradient, микроцентрифуги микродозаторов автоматических, термостат для Eppendorf Minispin, микропробирок Термит, камеры для горизонтального электрофореза SE-2 и SEи вертикального – VE-3 фирмы Хеликон (Москва), трансиллюминатор Vilber Lourmat, реактивов и расходных материалов для ПЦР и электрофореза, автоматический генетический анализатор/секвенатор ABI Prism 3130.

Материалом для исследований послужили отечественные сорта и элитные формы яблони коллекции генетических ресурсов СКЗНИИСиВ и ВНИИСПК (в рамках выполненных совместных проектов РФФИ), предоставленные селекционерами Е.В. Ульяновской, Е.Н. Седовым, С.Н. Артюх и И.Л. Ефимовой, а также иностранные сорта яблони: Прима, Голден Делишес, Ред Делишес, Айдаред, Ренет Симиренко, Мекинтош (приложение 1-2) [Артюх С.Н. и др., 1998; Седов Е.Н., 2005; Ульяновская Е.В., 2008].

В качестве сорта-стандарта, несущего ген Vf, использовали сорт Прима американской селекции, что связано с наличием в международной научной литературе информации об аллельных состояниях изучаемых микросателлитных локусов у данного сорта. При проведении анализа образцов яблони на предмет наличия доминантной аллели гена Vm в качестве стандарта наличия гена использовали сорт Орловский пионер, селекции ВНИИСПК (г. Орел). Это было обусловлено наличием многолетних данных о присутствии у данного сорта искомого гена, полученных путем фитопатологического тестирования. Кроме того, одна из родительских форм (SR 0523) данного сорта является общеизвестным донором гена Vm.

Стандартами при анализе полиморфизма локуса S-гена послужили сорта иностранной селекции с известным из литературных данных аллельным набором S-локуса: Голден Делишес – S2, S3; Айдаред – S7; Мекинтош – S10 [Супрун И.И. и др., 2010].

2.2 Молекулярные маркеры, использованные в работе

В качестве ДНК-маркера гена использовали Vm Hi07h02

(F: CAAATTGGCAACTGGGTCTG; R: GTTTAGGTGGAGGTGAAGGGATG).

В качестве ДНК-маркера гена Vf – внутригенный маркер (прямой праймер – VfC1F: 5`GGTTTCCAAAGTCCAATTCC3`; обратный праймер – VfC2R: 5`CGTTAGCATTTTGAGTTGAC3`), аллельный полиморфизм которого обусловлен наличием инсерций у рецессивной аллели гена [Супрун И.И. и др., 2009].

Праймерные пары использованных ДНК-маркеров были синтезированы фирмами ЗАО «Синтол», г. Москва, и фирмой «Бигль», г. Санкт-Петербург.

В работе по определению степени генетического родства отечественных сортов яблони коллекции генетических ресурсов СКЗНИИСиВ и ВНИИСПК использовали 12 нейтральных (то есть не сцепленных ни с каким признаком) микросателлитных маркеров, имеющих кодоминантный характер наследования и характеризующихся высоким уровнем полиморфизма. Микросателлитные маркеры (SSR) отбирали из базы данных www. hidras.unimi.it.

Список использованных SSR-маркеров приведён в таблице 2.

–  –  –

Для изучения полиморфизма локуса S-гена сортов яблони коллекции генетических ресурсов СКЗНИИСиВ и ВНИИСПК использовали ДНКмаркеры, приведенные в таблице 3.

–  –  –

Для экстракции ДНК использовали ЦТАБ-метод, придерживаясь следующей схемы: образцы растительной ткани яблони вносили в микропробирки и растирали с прогретым до 60 С 2-кратным ЦТАБ-буфером, содержащим 2 % ЦТАБ (цетилтриметиламмоний бромид), 1,4 M хлористого натрия, 0,1 M Трис-гидрохлорид, 20 мМ ЭДТА (этилендиаминотетраацетат).

При этом соблюдали соотношение 500 мкл буфера на 0,1 г ткани. Образцы инкубировали 3 часа при 60 С, после чего вносили равный объем хлороформа и инкубировали при перемешивании в течение 20 минут. На следующем этапе образцы центрифугировали 10 минут при 5000 об-1, отбирали супернатант, добавляли к нему 0,2 объема 5-кратного ЦТАБ-буфера, содержащего 5 % ЦТАБ и 350 мМ ЭДТА и инкубировали 10 минут при 60 С. После инкубации в пробирки с образцами вносили равный объем хлороформа и инкубировали при перемешивании 20 минут, центрифугировали 10 минут при 5000 об-1, в чистую пробирку отбирали верхнюю фазу, добавляли к ней равный объем буфера для преципитации (1 % ЦТАБ, 50мМ Трис-гидрохлорид, 10мМ ЭДТА) и оставляли на ночь при комнатной температуре. После преципитации ДНК, осадок растворяли в 500 мкл солевого буфера (1 М хлористый натрий, 10 мМ Трисгидрохлорид, 1 мМ ЭДТА), добавляли 1 см3 этилового спирта (96 %) и оставляли при -20 С на 2-3 часа. По истечении этого времени, центрифугировали образцы 10 минут при 13000 об-1, затем промывали осадок этиловым спиртом (70 %), высушивали и растворяли в 100 мкл стерильной дистиллированной воды. Экстракцию проводили согласно методике, а также в модификации, включающей дополнительную очистку проб [Doyle J.J. et al., 1987; Murray M.G. et al., 1980; Rogers S.O. et al., 1985].

Для экстракции ДНК с применением сорбентного метода использовали коммерческие наборы «Diatom mini prep 200» согласно инструкции, производимые ООО «БИОКОМ», г. Москва.

ПЦР проводили по стандартным методикам с выполнением предварительной оптимизации ряда параметров, таких как температура отжига праймеров, длительность циклов отжига праймеров и элонгации, общее количество циклов, концентрация дезоксинуклеотидтрифосфатов, праймеров.

Амплификацию осуществляли наборами для проведения ПЦР (Сибэнзим, г. Новосибирск, Россия) в реакционном объеме 25 мкл. Параметры ПЦР смеси:

в 25 мкл смеси содержится нг ДНК, 0,25 мкM 40-50 dNTPs (дезоксинуклеотидтрифосфат), 0,2 мM каждого праймера; 2,5 мкл 10-кратного реакционного буфера, 2,5 мM MgCl2, 1 единица Taq-полимеразы.

ПЦР-программу проводили по следующим схемам:

1. Идентификация гена Vf: 3 минуты при 94 С – начальная денатурация, далее 35 циклов: 1 минута денатурация при 94 С, 1 минута отжиг праймеров при 56 С, 1 минута синтез при 72 С; последний цикл синтеза 5 минут при 72 С (концентрация dNTPs – 0,1 мкM, каждого праймера – 0,3 мкM).

2. Идентификация гена Vm: 3 минуты при 94 С – начальная денатурация, далее 35 циклов: 1 минута денатурация при 94 С, 1 минута отжиг праймеров при 58 С, 1 минута синтез при 72 С; последний цикл синтеза 5 минут при 72 С (концентрация dNTPs – 0,1 мкM, каждого праймера – 0,3 мкM).

3. Идентификация аллелей S-гена: 5 минут при 94 С – начальная денатурация, далее 35 циклов: 30 секунд денатурация при 94 С, 40 секунд отжиг праймеров при 60 С, 30 секунд синтез при 72 С; последний цикл синтеза 5 минут при 72 С (концентрация dNTPs – 0,1 мкM, каждого праймера – 0,3 мкM).

4. Амплификация с SSR-маркерами: 5 минут при 94 С – начальная денатурация, далее 30-33 цикла в зависимости от маркера: 30 секунд денатурация при 94 С, 30 секунд отжиг праймеров при 60 С (температуру отжига праймеров подбирали индивидуально для праймерных комбинаций), 30 секунд синтез при 72 С; последний цикл синтеза 3 минуты при 72 С (концентрация dNTPs – 0,1 мкM, каждого праймера – 0,3 мкM).

ДНК-амплификацию проводили в амплификаторе Терцик производства НПО ДНК-технологии (Россия) и Eppendorf Mastercycler gradient (Германия).

Для электрофоретического разделения продуктов ПЦР, полученных с ДНК-маркером гена Vf использовали 8%-ный акриламидный гель, а также 2%-ный агарозный гель на основе 0,5-кратного Трис-боратного буфера (0,045 M Трис, 0,045 M Борной кислоты, 1 мM ЭДТА, рН=8,2). Для анализа полиморфизма маркера гена Vm и при микросателлитном анализе использовали 8%-ный полиакриламидный гель на основе 1-кратного Трис-боратного буфера (0,09 M Трис, 0,09 M Борной кислоты, 2 мM ЭДТА, рН=8,2). Полимеризацию геля проводили при комнатной температуре в течение 1 часа. В качестве катализаторов полимеризации использовали ТЕМЕД и аммония персульфат, из расчета 40 мкл ТЕМЕДа (100% раствор) и 350 мкл аммония персульфата 10%-ного на 40 см3 раствора геля. Электрофорез проходил при напряжении 120 V в течение 30 минут в камерах для горизонтального электрофореза SE-2 и SE-3, а также при напряжении 220 V в течение 240 минут в камерах для вертикального электрофореза VE-3 фирмы Хеликон (Москва).

После окончания полимеризации лунки геля промывали электродным буфером (1-кратный Трис-боратный буфер) и проводили предварительный электрофорез без внесенных образцов, для удаления из геля остатков катализаторов и незаполимеризовавшегося акриламида, при напряжении 150 V, в течение 1 часа.

Для электрофореза использовали 12 мкл реакционной смеси, которую смешивали с 1 мкл неденатурирующего буфера нанесения (40 % сахароза, 0,025 % бромфеноловый синий, 0,025 % ксилен цианол) и наносили в лунки геля под слой электродного буфера.

После проведения электрофореза гелевые пластины помещали на 20 минут в раствор бромистого этидия (5 мкг/см3), и фотографировали в УФ-спектре.

Для предварительной проверки концентрации ДНК в выделенных пробах использовали метод разведений полученных препаратов с последующим их электрофорезом в 2%-ном агарозном геле, содержащем 1 мкг/см3 бромистого этидия и визуализацией в УФ-спектре. При этом исходили из того, что порог чувствительности бромистого этидия в агарозных гелях составляет 10 нг ДНК [Остерман Л.А., 1981]. При постановке ПЦР на одну реакцию оптимальным было определено количество ДНК 40-50 нг. Размер аллелей определяли путем сравнения со стандартным образцом – pBR322/BsuR I (Хеликон, Россия).

Фрагментный анализ SSR-маркеров проводили на автоматическом генетическом анализаторе-секвенаторе ABI Prism 3110.

2.4 Статистическая обработка данных

При оценке результатов микросателлитного анализа матрица генетических дистанций была построена с использованием коэффициентов (индексов) подобия по M. Nei и W. Li (1979) [Nei M. et al., 1979]. Кластерный анализ выполнен методом попарного невзвешенного кластирования с арифметическим усреднением (UPGMA) и методом ближайших соседей (NJ), с использованием FreeTree Application 0.9.1.50 (ZDAT v.o.s.). Графическое построение дендрограммы проведено в программе TreeView (Win32) 1.6.6.

Фактическая (Ho) и ожидаемая (He) гетерозиготность, эффективное число аллелей (Na) рассчитаны в соответствии с Martines et al. (2006) с использованием программы GenAlEx 6.3 [Martinez L.E. et al., 2006].

Количество выявленных аллелей (Na) по изученным SSR-локусам характеризует количество аллелей, идентифицированное по конкретному SSRлокусу в изученной выборке генотипов. Функцией от доли полиморфных локусов, числа аллелей на локус и выравненности частот аллелей является эффективное число аллелей (Ne) и, таким образом, оно является мерой генетического разнообразия. Эффективное число аллелей оценивает величину, обратную гомозиготности, и представляет собой такое число аллелей, при одинаковой частоте которых гетерозиготность будет равна фактической.

Отношение фактической гетерозиготности (Ho) к ожидаемой (He) характеризует уровень генетической полиморфности данных локусов внутри изученной группы сортов.

3 ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ

–  –  –

В связи с высоким содержанием загрязнителей (полисахариды и полифенольные соединения) в тканях яблони на начальном этапе работы была выполнена апробация различных методов экстракции ДНК с поиском оптимальных, требующих минимальных временных и финансовых затрат.

В качестве исходных тканей для проведения экстракции ДНК яблони использовали нераскрывшиеся почки, кору 1-2 летних побегов, лист на различных этапах вегетационного развития, высушенный лист. Во время проведения экстракции на первом этапе для гомогенизации использовали растирание образцов в жидком азоте, с последующим внесением измельченной ткани в пробирку с экстрагирующим буфером, а также измельчение непосредственно в пробирке с буфером. В ходе работы не выявили различий по количеству экстрагируемой ДНК при использовании разных способов измельчения ткани. В дальнейшем использовали измельчение в буфере без использования жидкого азота и следующие методы экстракции

ДНК:

1. Метод ЦТАБ, основанный на использовании цетилтриметиламмоний бромида в качестве основного детергента, входящего в состав лизирующего буфера. При усовершенствовании данного метода экстракции ДНК в качестве базовых использовали варианты ЦТАБ-метода [Murray M.G. et al., 1980; Doyle J.J. et al., 1987; Rogers S.O. et al., 1985]. Применяли экстрагирующий буфер следующего состава: ЦТАБ (2 %), 1,4 М хлористого натрия, 0,1 М Трисгидрохлорид, 20 мМ ЭДТА. В качестве модификации внесли дополнительные этапы очистки проб ДНК яблони. Для этого, после этапа вторичной депротеинизации (базовый метод), проводили преципитацию проб в буфере преципитации (1 % ЦТАБ, 50 мМ Трис-HCl, 10 мМ ЭДТА). После

–  –  –

Результаты исследований показали, что наиболее эффективным для экстракции ДНК является использование листовых тканей в фазу распускания почек и начального этапа роста листовой пластинки. Данный факт является известным. В тоже время, модификация с PVP (1 %) в экстрагирующем буфере и двумя этапами очистки/переосаждения показала эффективность и для экстракции ДНК из листовой пластины на поздних стадиях вегетации. Это позволило получить пробы ДНК, пригодные для проведения ПЦР из листьев, гербаризованных на поздних этапах вегетации (за 1-2 недели до начала листопада и во время него), хотя в данном случае концентрация ДНК в получаемых препаратах была существенно ниже [Супрун И.И. и др., 2010].

Для предварительной проверки концентрации ДНК в выделенных пробах использовали метод разведений полученных препаратов с последующим их электрофорезом в 2%-ном агарозном геле, содержащем 1 мкг/мл бромистого этидия и визуализацией в ультрафиолете. При этом исходили из того, что порог чувствительности бромистого этидия в агарозных гелях составляет 10 нг ДНК [Aharon A. et al., 2001]. Для проверки количества экстрагированной ДНК при электрофорезе в лунки геля вносили пробы равного объема. По интенсивности свечения электрофоретического спектра ДНК определяли ее относительную концентрацию (рисунок 1).

Рисунок 1 – Электрофорез проб ДНК, экстрагированных методом ЦТАБ на разных этапах вегетационного развития листа (целевой спектр отмечен стрелкой), где 1 – 3 – молодой лист (использовали различное количество растительной ткани для экстракции: 1; 2; 3 1,5; 1; 0,75 см2 листа); 4 – 7 – полностью сформировавшийся лист (1,5 см2 листа); 8 – старый лист (1,5 см2 листа) Как видно из рисунка 1, наилучшие условия экстракции ДНК обеспечиваются из молодых листьев яблони. Модифицированный ЦТАБ-метод был апробирован как при использовании свежей ткани листа, так и для листьев яблони, гербаризованных на разных этапах вегетации. Во всех случаях его применение позволяло экстрагировать пробы ДНК со степенью чистоты, достаточной для проведения ПЦР, следовательно, данная модификация метода ЦТАБ была признана эффективной и универсальной и использовалась в работе.

3.2 Идентификация генов Vf и Vm у отечественных сортов и селекционных форм яблони В связи с актуальностью вопроса создания иммунных к парше сортов яблони, а также наличием информации об имеющихся ДНК-маркерах к гену устойчивости Vf, комплекс исследований, направленных на внедрение технологии ДНК-маркирования в селекцию яблони, включал в себя несколько последовательных этапов.

Для апробации ДНК-маркера гена устойчивости яблони к парше Vf использовали ДНК сорта Прима селекции США – общеизвестного донора указанного гена. При постановке ПЦР и дальнейшем проведении электрофоретического анализа у данного сорта выявили ПЦР продукт, соответствующий доминантному аллелю гена, что позволило использовать его как положительный стандарт наличия гена Vf. Также на начальном этапе эксперимента в качестве сортов-стандартов были взяты сорта Василиса, Солнышко, Рассвет, обладающие геном Vf иммунитета к парше по данным фитопатологического тестирования.

Апробация ДНК-маркера гена Vf при различных температурах отжига праймеров показала, что при повышении температуры отжига до 60 С амплификация не наблюдалась. На этапе оптимизации параметров ПЦР для ДНК-маркера гена Vf оптимальной была определена температура отжига 56 С при следующей схеме протекания реакции: 3 минуты при 94 С – начальная денатурация, следующих 35 циклов: 1 минута денатурация при 94 С, 1 минута отжиг праймеров при 56 С, 1 минута синтез при 72 С; последний цикл синтеза 5 минут при 72С. Оптимальной концентрацией дезоксинуклеотидтрифосфатов в ПЦР-смеси определили концентарцию 0,2 мкM, в дальнейшем концентрация дезоксинуклеотидтрифосфатов была снижена до 0,1 мкM без ухудшения синтеза целевых продуктов. Оптимальной концентрацией для праймеров была определена концентрация 0,3 мкM. ДНК вносили в количестве по 40-50 нг в реакцию [Супрун И.И. и др., 2010].

Использование для ДНК-анализа оптимального метода экстракции ДНК, а также параметров ПЦР, позволивших получать максимальный синтез целевых участков, дало возможность четко идентифицировать аллели гена устойчивости яблони к парше Vf.

На рисунке 2, приведены результаты ДНК-анализа ряда сортов и элитных форм яблони, на заключительном этапе апробации ДНК-маркера.

МВ

Рисунок 2 – Электрофоретический анализ ПЦР продуктов ДНК маркера гена Vf у отечественных сортов и элитных форм яблони, где 1-3 – элитные формы яблони: 1 – 12/2-21-4, 2 – 12/2-20-1, 3 – 12/1-21-68; 4-9 – сорта яблони:

4 – Василиса, 5 – Первинка, 6 – Солнышко, 7 – Рассвет, 8 – Орловский пионер, 9 – Прима, МВ – маркер молекулярного веса ДНК Как видно из рисунка 2, у образцов 1, 3, 4, 6, 7, 9 синтезируется продукт специфичный только для них (отмечен стрелкой). Данный продукт с молекулярной массой 286 п. н. синтезируется с участка доминантного аллеля гена Vf. В данном случае сортом-стандартом наличия гена Vf являлся сорт Прима, который в настоящее время наиболее часто используется как сортдонор этого гена в селекционных программах яблони. Образцы 1, 3, 4, 6, 7, как и стандарт, имеют указанный ПЦР-фрагмент. Это свидетельствует о наличии у них доминантного аллеля искомого гена, причем у сортов Василиса, Солнышко, Рассвет наличие гена Vf было подтверждено проводимыми ранее фитопатологическими исследованиями [Супрун И.И. и др., 2010].

С использованием оптимизированных экспериментальных параметров ПЦР был проведен ДНК-анализ ряда сортов и форм яблони (рисунок 3, 4).

МВ Рисунок 3 – Электрофоретический анализ ПЦР продуктов ДНК маркера гена Vf сортов и элитных форм яблони, где 1 – Ренет Симиренко (стандарт Vf-);

2 – 12/1-21-33; 3 – 12/1-21-62; 4 – Айдаред; 5 – 12/1-21-43; 6 – 12/3-21-9; 7 – Ред Делишес; 8 – Голд Раш; 9 – Прима стандарт Vf+); МВ – маркер молекулярного веса ДНК Как видно из рисунка 3 специфический ПЦР-фрагмент (уровень отмечен стрелкой), подтверждающий наличие гена Vf, обнаружен у 4 элитных форм яблони: 12/1-21-33, 12/1-21-62, 12/1-21-43, 12/3-21-9, а также сорта Голд Раш.

В процессе работы были оптимизацированы такие параметры электрофоретического разделения продуктов ПЦР как напряжение электрического поля и время электрофореза. Изначально использовали полиакриламидный гель в концентрации 8 %, который в дальнейшем был заменен на 2 %-ный агарозный, оказавшийся более удобным в применении, причем оптимальным было определено напряжение электрического поля 5 V/см при времени проведения электрофореза 30 минут.

На рисунке 4 представлен пример электрофоретического разделения продуктов ПЦР в 2 %-ном агарозном геле.

Рисунок 4 – Электрофоретический анализ ПЦР продуктов ДНК маркера гена Vf у сортов и селекционных форм яблони в 2 % агарозном геле, где МВ – маркер молекулярной массы ДНК; 1, 10 – сорт-стандарт Прима; 2– Зефир; 3 – Юбилей Москвы; 4 – Ноктюрн; 5 – Фея; 6 – 44-29-61-СЗ; 7 – 44-27-74-В; 8 – 44-29-9-С; 9 – 44-29-39-В; 11 – 44-27-38-В; 12 – 44-29-30-З; 13 – 44-25-71-СЗ;

14 – 44-27-29-В; 15 – 44-24-38-С; 16 – К-90; 17 – 44-24-49-Ю; 18 – 44-27-38-В Результаты электрофореграммы, изображенной на рисунке 4 (стрелкой отмечен целевой фрагмент), подтверждают перспективность использования 2 % агарозного геля для электрофоретического разделения продуктов ПЦР.

С применением оптимизированных параметров ПЦР и электрофореза был проведен массовый скрининг селекционного материала яблони, обладающего комплексом ценных агробиологических признаков [Супрун И.И. и др., 2011]. В таблице 5 показаны результаты идентификации гена Vf у сортов и элитных форм яблони отечественной селекции.

–  –  –

1) Василиса, Екатеринодарское, Кармен, Любава, Прима Ноктюрн, Тайна, Юнона, 12/1-21-33, 12/1-21-80, 12/2-20-20, 12/2-20-27, 12/2-21-2, 12/3-20-15, 12/3-20-16, 12/3-20-17, 28-41-44, 28-42-32, 44-24-49-Ю, 44-27-52-СЗ, 44-27-60-С, 44-27-74-В, 44-27-75-З, 44-29-9-С, К-90

–  –  –

Для указанных сортов и селекционных форм яблони ранее было проведено фитопатологическое тестирование на искусственном инфекционном фоне во ВНИИСПК г. Орел, в ходе которого была выявлена их высокая степень устойчивости к патогену, что свидетельствует о наличии у них гена Vf. Таким образом, полученные результаты молекулярно-генетического анализа по идентификации гена Vf подтверждают данные фитопатологической оценки и имеющиеся сведения о происхождении изученных сортов и селекционных форм яблони и свидетельствуют об эффективности выбранного метода.

На следующем этапе работы проводилась апробация ДНК-маркера к гену Vm с оптимизацией параметров ПЦР и электрофореза. В качестве стандартной была взята ДНК сорта яблони Прима, что связано с наличием информации о размере ПЦР-продукта по данному маркеру в литературных источниках.

Из основных параметров следует отметить температуру отжига праймерной пары. В ходе экспериментальной работы была определена температура отжига 58 °С. Оптимальной концентрацией дезоксинуклеотидтрифосфатов в ПЦР-смеси определили концентрацию 0,1 мкM; концентрация для праймеров – 0,3 мкM. ДНК вносили в количестве по 40-50 нг в реакцию [Супрун И.И. и др., 2009].

При проведении анализа образцов яблони на предмет наличия доминантного аллеля гена Vm в качестве стандарта наличия гена использовали сорт Орловский пионер, селекции ВНИИСПК (г. Орел). При постановке ПЦР и дальнейшем проведении электрофоретического анализа у данного сорта выявлялся ПЦР продукт размером порядка 230 п. н. – отмечен стрелкой (рисунок 5), что соответствует литературным данным о размере ПЦР продукта в случае наличия доминантного аллеля гена [Седов Е.Н. и др., 2006].

На рисунке 5 представлено электрофоретическое разделение продуктов ПЦР у сортов и элитных селекционных форм яблони отечественной селекции.

Из рисунка видно, что специфический ПЦР-фрагмент в 230 п. н., соответствующий доминантному аллелю гена Vm, обнаружен у 6 элитных форм яблони: 31-34-40, 29-7-101, 31-31-128, 27-2-276, 27-2-222, 27-2-218.

–  –  –

В ходе выполнения анализа биоматериала ряда сортов и форм яблони селекции ВНИИСПК ген Vm был идентифицирован у сорта Первинка и следующих элитных форм: 31-34-40, 31-31-128, 27-2-276, 27-2-222, 29-7-101, 27-2-218 [Супрун И.И. и др., 2010].

Результаты работы позволяют говорить об информативности использования выбранного ДНК-маркера для идентификации гена Vm.

Полученные экспериментальные данные подтверждают перспективность дальнейших исследований, направленных на идентификацию генов устойчивости к парше Vf и Vm в селекционном материале яблони, в том числе и в образцах, несущих одновременно два гена устойчивости.

3.3 Совершенствование ДНК-маркерной идентификации гена Vf иммунитета яблони к парше При использовании известного на сегодняшний день ДНК-маркера VfC к гену Vf, созданного на основе данных о его нуклеотидной последовательности, наряду с аллель-специфичным фрагментом размером 286 п. н., синтезируется два неспецифических фрагмента размером 484 и 646 п. н. у образцов как с доминантным, так и с рецессивным аллелем гена Vf [Урбанович О.Ю. и др., 2009; Afunian M.R. et al., 2004]. Несмотря на то, что наличие указанных неспецифических фрагментов не препятствует достоверной идентификации доминантного аллеля, это может снижать эффективность одновременной идентификации данного гена в сочетании с генами других хозяйственноценных признаков при проведении мультиплексной ПЦР.

Так, к примеру, доминантный аллель гена устойчивости к мучнистой росе характеризуется ДНК-маркером с размером Pl-1 OPAT20-450 амплифицируемого фрагмента 450 п. н. [Markussen T. et al., 1995]. Для гена устойчивости к данному заболеванию яблони – Pl-2 известен ДНК-маркер с размером фрагмента, специфичного для доминантного аллеля в 269 п. н. Для гена Pl-w создан ДНК-маркер с целевым фрагментом, размером 250 п. н. [Evans K.M. at al., 2003].

Для повышения перспективности и эффективности возможного применения мультиплексной ПЦР для одновременной идентификации гена Vf с указанными генами устойчивости к мучнистой росе, задачей данного исследования являлось создание ДНК-маркера к гену Vf, позволяющему получать единичный ПЦР продукт для доминантного аллеля и отсутствие такового для рецессивного.

После выравнивания нуклеотидных последовательностей аллелей Vfa1 (HcrVf1), Vfa2 (HcrVf2) и Vfa4 (HcrVf3) (номера в базе данных NCBI AJ297739, AJ297740 и AJ297741) в программе ClustalW (www.ebi.ac.uk./clustalw/.), провели их сравнение с учетом того, что Vfа4 является доминантным аллелем гена устойчивости яблони к парше Vf и определили полиморфный участок для создания нового ДНК-маркера [Afunian M.R. et al., 2004]. Учитывая все перечисленные условия, были подобраны подходящие участки, на которые можно производить отжиг праймеров. Они изображены на рисунке 6.

На представленном рисунке жирным шрифтом обозначены позиции праймеров ДНК-маркера, известного из литературных источников и использованного нами в работе: F-прямой и R-обратный праймер. Выделен жирным шрифтом, курсивом и подчеркнут участок последовательности Vfа4, отобранный в качестве целевого для создания нового ДНК-маркера. Участок последовательности Vfа4, на который был создан дополнительный обратный праймер, имеет, достаточный уровень отличия от последовательностей Vfа1 и Vfа2. Новое сочетание праймеров F+R1 дает возможность синтезировать продукт ПЦР размером около 140 п. н. только с последовательности Vfа4.

F

Vfа2 CTTAAAAATCTAGTTTCTCTTCATCTCAGTTTTTGTGGTTTCCAAAGTCCAATTCCTAGC 908

Vfа4 CTTAAAAATCTAGTTTCTATTCATCTCAGTGATTGTGGTTTCCAAGGTCCAATTCCTAGC 916

Vfа1 CTTAAAAATCTAGTTTCTCTTCATCTCAGGTTTTGTGGTTTCCAAGGTCCAATTCCTAGC 1194

****************** ********** ************* ************** ………………………………………………………………………………………………………………………………………………………………………………………………………… …………………………………………………………………………………………………………………………………………………………………………………………………………

Vfа2 CAACTTACAGGACAACTTCCAAGAAGTATTCAGAATATGACTGGTCTTACAACTCTTAAT 1088

Vfа4 ------------------------------------ATG--TGGTC-------------- 1019

Vfа1 CAACTTACAGGACAACTTCCAAGCAGTTTTCAAAATATGACTGGTCTTAAAGTTCTTAAT 1374

*** ***** R1

Vfа2 CTCGGGGGGAACGAATTCAATTCTACCATACCTGAATGGTTGTATAGCTTGAACAATCTC 1148

Vfа4 --CAGATGGAATAAAGTCA--------------------TTGT----------------- 1040

Vfа1 CTTGAGAGTAACTACTTCAATTCTACCATACCTAAATGGTTGTATGGCTTGAACAATCTC 1434



Pages:     | 1 || 3 | 4 |

Похожие работы:

«Карачевцев Захар Юрьевич ОЦЕНКА ПИЩЕВЫХ (АКАРИЦИДНЫХ) СВОЙСТВ РЯДА СУБТРОПИЧЕСКИХ И ТРОПИЧЕСКИХ РАСТЕНИЙ В ОТНОШЕНИИ ПАУТИННОГО КЛЕЩА TETRANYCHUS ATLANTICUS MСGREGOR Специальность: 06.01.07 – защита растений Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель: Попов Сергей...»

«Цховребова Альбина Ирадионовна ВЛИЯНИЕ ФАКТОРОВ СРЕДЫ НА РАЗВИТИЕ БЕСХВОСТЫХ АМФИБИЙ СЕВЕРНЫХ СКЛОНОВ ЦЕНТРАЛЬНОГО КАВКАЗА Специальность 03.02.14 – биологические ресурсы Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель доктор биологических наук профессор Калабеков Артур Лазаревич Владикавказ 2015 Содержание Ведение..3 Глава I. Обзор литературных данных. 1.1....»

«Ульянова Онега Владимировна МЕТОДОЛОГИЯ ПОВЫШЕНИЯ БЕЗОПАСНОСТИ БАКТЕРИАЛЬНЫХ ВАКЦИН НА МОДЕЛИ ВАКЦИННЫХ ШТАММОВ BRUCELLA ABORTUS 19 BA, FRANCISELLA TULARENSIS 15 НИИЭГ, YERSINIA PESTIS EV НИИЭГ 03.02.03 – микробиология Диссертация на соискание ученой степени доктора биологических наук Научный консультант:...»

«Степина Елена Владимировна ЭКОЛОГО-ФЛОРИСТИЧЕСКАЯ ХАРАКТЕРИСТИКА СТЕПНОЙ РАСТИТЕЛЬНОСТИ ЮГО-ЗАПАДНЫХ РАЙОНОВ САРАТОВСКОЙ ОБЛАСТИ 03.02.08 – экология (биологические науки) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор...»

«АБДУЛЛАЕВ Ренат Абдуллаевич ГЕНЕТИЧЕСКОЕ РАЗНООБРАЗИЕ МЕСТНЫХ ФОРМ ЯЧМЕНЯ ИЗ ДАГЕСТАНА ПО АДАПТИВНО ВАЖНЫМ ПРИЗНАКАМ Шифр и наименование специальности 03.02.07 – генетика 06.01.05 – селекция и семеноводство сельскохозяйственных растений ДИССЕРТАЦИЯ на соискание учёной степени кандидата...»

«БРИТАНОВ Николай Григорьевич ГИГИЕНИЧЕСКИЕ АСПЕКТЫ ПЕРЕПРОФИЛИРОВАНИЯ ИЛИ ЛИКВИДАЦИИ ОБЪЕКТОВ ПО ХРАНЕНИЮ И УНИЧТОЖЕНИЮ ХИМИЧЕСКОГО ОРУЖИЯ 14.02.01 Гигиена Диссертация на соискание ученой степени доктора медицинских наук Научный консультант: доктор медицинских наук, профессор...»

«Шинкаренко Андрей Семенович Формирование безопасного и здорового образа жизни школьников на современном этапе развития общества Специальность 13.00.01– общая педагогика, история педагогики и образования Диссертация на соискание ученой степени кандидата педагогических наук Научные...»

«Ульянова Онега Владимировна МЕТОДОЛОГИЯ ПОВЫШЕНИЯ БЕЗОПАСНОСТИ БАКТЕРИАЛЬНЫХ ВАКЦИН НА МОДЕЛИ ВАКЦИННЫХ ШТАММОВ BRUCELLA ABORTUS 19 BA, FRANCISELLA TULARENSIS 15 НИИЭГ, YERSINIA PESTIS EV НИИЭГ 03.02.03 – микробиология Диссертация на соискание ученой степени доктора биологических наук Научный консультант:...»

«ШУБНИКОВА ЕЛЕНА ВЛАДИМИРОВНА ВЛИЯНИЕ ФИЗИКО-ХИМИЧЕСКИХ ФАКТОРОВ И ФОРМ АДАПТИВНОЙ ИЗМЕНЧИВОСТИ НА ЧУВСТВИТЕЛЬНОСТЬ ПАТОГЕННЫХ БУРКХОЛЬДЕРИЙ К ХИМИОТЕРАПЕВТИЧЕСКИМ ПРЕПАРАТАМ 03.02.03 –...»

«Хохлова Светлана Викторовна ИНДИВИДУАЛИЗАЦИЯ ЛЕЧЕНИЯ БОЛЬНЫХ РАКОМ ЯИЧНИКОВ 14.01.12-онкология ДИССЕРТАЦИЯ На соискание ученой степени доктора медицинских наук Научный консультант: Доктор медицинских наук, профессор Горбунова В.А Москва 2015 ОГЛАВЛЕНИЕ Введение Глава 1. Обзор литературы 1.1. Общая характеристика рака яичников 1.1.1. Молекулярно-биологические и...»

«Мухаммед Тауфик Ахмед Каид ХАРАКТЕРИСТИКА ГЕНОТИПОВ С ХОРОШИМ КАЧЕСТВОМ КЛЕЙКОВИНЫ, ОТОБРАННЫХ ИЗ ГИБРИДНЫХ ПОПУЛЯЦИЙ АЛЛОЦИТОПЛАЗМАТИЧЕСКОЙ ЯРОВОЙ ПШЕНИЦЫ МЯГКОЙ С ИСПОЛЬЗОВАНИЕМ ДНК-МАРКЕРОВ Специальность 06.01.05 – селекция и семеноводство сельскохозяйственных растений Диссертация на соискание ученой степени кандидата сельскохозяйственных наук Научный...»

«Сафранкова Екатерина Алексеевна КОМПЛЕКСНАЯ ЛИХЕНОИНДИКАЦИЯ ОБЩЕГО СОСТОЯНИЯ АТМОСФЕРЫ УРБОЭКОСИСТЕМ Специальность 03.02.08 – экология (биологические науки) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор...»

«ХАПУГИН Анатолий Александрович РОД ROSA L. В БАССЕЙНЕ РЕКИ МОКША 03.02.01 – ботаника Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель Силаева Татьяна Борисовна д.б.н., профессор САРАНСК ОГЛАВЛЕНИЕ ВВЕДЕНИЕ Глава 1. ИСТОРИЯ ИЗУЧЕНИЯ РОДА ROSA L. В БАССЕЙНЕ МОКШИ. Глава 2. КРАТКАЯ ХАРАКТЕРИСТИКА РОДА ROSA L. 2.1. Характеристика рода Rosa L. 2.2. Систематика рода Rosa L. Глава 3....»

«Моторыкина Татьяна Николаевна ЛАПЧАТКИ (РОД POTENTILLA L., ROSACEAE) ФЛОРЫ ПРИАМУРЬЯ И ПРИМОРЬЯ 03.02.01 – Ботаника Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, старший научный сотрудник Н.С. Пробатова Хабаровск Содержание Введение... Глава 1. Природные...»

«КОЖАРСКАЯ ГАЛИНА ВАСИЛЬЕВНА КЛИНИЧЕСКОЕ ЗНАЧЕНИЕ МАРКЕРОВ КОСТНОГО МЕТАБОЛИЗМА У БОЛЬНЫХ РАКОМ МОЛОЧНОЙ ЖЕЛЕЗЫ 14.01.12 онкология Диссертация на соискание ученой степени кандидата медицинских наук Научные руководители: доктор биологических наук, Любимова Н.В. доктор медицинских наук, Портной С.М. Москва, 2015 г....»

«СЕРГЕЕВА ЛЮДМИЛА ВАСИЛЬЕВНА ПРИМЕНЕНИЕ БАКТЕРИАЛЬНЫХ ЗАКВАСОК ДЛЯ ОПТИМИЗАЦИИ ФУНКЦИОНАЛЬНО-ТЕХНОЛОГИЧЕСКИХ СВОЙСТВ МЯСНОГО СЫРЬЯ И УЛУЧШЕНИЯ КАЧЕСТВА ПОЛУЧАЕМОЙ ПРОДУКЦИИ Специальность 03.01.06 – биотехнология ( в том числе бионанотехнологии) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель Доктор биологических наук, профессор Кадималиев Д.А. САРАНСК 2014 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ.....»

«Ядрихинская Варвара Константиновна ЭКОЛОГИЧЕСКИЕ ОСОБЕННОСТИ РАСПРОСТРАНЕНИЯ ОСТРЫХ КИШЕЧНЫХ ИНФЕКЦИЙ В Г. ЯКУТСКЕ И РЕСПУБЛИКЕ САХА (ЯКУТИЯ) 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель кандидат биологических наук, доцент М.В. Щелчкова Якутск 2015...»

«Якимова Татьяна Николаевна Эпидемиологический надзор за дифтерией в России в период регистрации единичных случаев заболевания 14.02.02 эпидемиология диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор...»

«Доронин Максим Игоревич ЭКСПРЕСС-МЕТОДЫ ВЫЯВЛЕНИЯ ВИРУСА ИНФЕКЦИОННОГО НЕКРОЗА ГЕМОПОЭТИЧЕСКОЙ ТКАНИ ЛОСОСЕВЫХ РЫБ 03.02.02 «Вирусология» Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, Мудрак Наталья Станиславовна Владимир 2015 ОГЛАВЛЕНИЕ 1 ВВЕДЕНИЕ 2 ОБЗОР ЛИТЕРАТУРЫ 2.1 Характеристика возбудителя инфекционного...»

«БРИТАНОВ Николай Григорьевич ГИГИЕНИЧЕСКИЕ АСПЕКТЫ ПЕРЕПРОФИЛИРОВАНИЯ ИЛИ ЛИКВИДАЦИИ ОБЪЕКТОВ ПО ХРАНЕНИЮ И УНИЧТОЖЕНИЮ ХИМИЧЕСКОГО ОРУЖИЯ 14.02.01 Гигиена Диссертация на соискание ученой степени доктора медицинских наук Научный консультант: доктор медицинских наук, профессор...»







 
2016 www.konf.x-pdf.ru - «Бесплатная электронная библиотека - Авторефераты, диссертации, конференции»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.